ID: 905851790

View in Genome Browser
Species Human (GRCh38)
Location 1:41280104-41280126
Sequence GCCTGCAGGGTAGAGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851783_905851790 -1 Left 905851783 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851774_905851790 27 Left 905851774 1:41280054-41280076 CCCTGACCTCCAGCCCCAGGGCC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851776_905851790 21 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851780_905851790 12 Left 905851780 1:41280069-41280091 CCAGGGCCATCAGCCCTGCCAAT No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851773_905851790 28 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851786_905851790 -6 Left 905851786 1:41280087-41280109 CCAATGAGGAGTGTGAGGCCTGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851777_905851790 18 Left 905851777 1:41280063-41280085 CCAGCCCCAGGGCCATCAGCCCT No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851778_905851790 14 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851775_905851790 26 Left 905851775 1:41280055-41280077 CCTGACCTCCAGCCCCAGGGCCA No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851779_905851790 13 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851782_905851790 6 Left 905851782 1:41280075-41280097 CCATCAGCCCTGCCAATGAGGAG No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851785_905851790 -2 Left 905851785 1:41280083-41280105 CCTGCCAATGAGGAGTGTGAGGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851790 Original CRISPR GCCTGCAGGGTAGAGTCAGA GGG Intergenic
No off target data available for this crispr