ID: 905856189

View in Genome Browser
Species Human (GRCh38)
Location 1:41316280-41316302
Sequence CCAGCTCGGGGCCATCCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905856189_905856198 25 Left 905856189 1:41316280-41316302 CCCGATGGATGGCCCCGAGCTGG No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856189_905856197 17 Left 905856189 1:41316280-41316302 CCCGATGGATGGCCCCGAGCTGG No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data
905856189_905856196 12 Left 905856189 1:41316280-41316302 CCCGATGGATGGCCCCGAGCTGG No data
Right 905856196 1:41316315-41316337 ATAAAAAAGAAAATCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905856189 Original CRISPR CCAGCTCGGGGCCATCCATC GGG (reversed) Intergenic