ID: 905856197

View in Genome Browser
Species Human (GRCh38)
Location 1:41316320-41316342
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905856191_905856197 16 Left 905856191 1:41316281-41316303 CCGATGGATGGCCCCGAGCTGGT No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data
905856193_905856197 4 Left 905856193 1:41316293-41316315 CCCGAGCTGGTTCAGCAGCCTCA No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data
905856192_905856197 5 Left 905856192 1:41316292-41316314 CCCCGAGCTGGTTCAGCAGCCTC No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data
905856189_905856197 17 Left 905856189 1:41316280-41316302 CCCGATGGATGGCCCCGAGCTGG No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data
905856194_905856197 3 Left 905856194 1:41316294-41316316 CCGAGCTGGTTCAGCAGCCTCAT No data
Right 905856197 1:41316320-41316342 AAAGAAAATCCTCAGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type