ID: 905856198

View in Genome Browser
Species Human (GRCh38)
Location 1:41316328-41316350
Sequence TCCTCAGAGGTCAGGCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905856192_905856198 13 Left 905856192 1:41316292-41316314 CCCCGAGCTGGTTCAGCAGCCTC No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856194_905856198 11 Left 905856194 1:41316294-41316316 CCGAGCTGGTTCAGCAGCCTCAT No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856195_905856198 -6 Left 905856195 1:41316311-41316333 CCTCATAAAAAAGAAAATCCTCA No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856193_905856198 12 Left 905856193 1:41316293-41316315 CCCGAGCTGGTTCAGCAGCCTCA No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856191_905856198 24 Left 905856191 1:41316281-41316303 CCGATGGATGGCCCCGAGCTGGT No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data
905856189_905856198 25 Left 905856189 1:41316280-41316302 CCCGATGGATGGCCCCGAGCTGG No data
Right 905856198 1:41316328-41316350 TCCTCAGAGGTCAGGCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905856198 Original CRISPR TCCTCAGAGGTCAGGCATCA AGG Intergenic