ID: 905856792

View in Genome Browser
Species Human (GRCh38)
Location 1:41319834-41319856
Sequence CTGTAAATGAAAAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905856792_905856800 8 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856800 1:41319865-41319887 ACTGAAATCCAGAGGTGGGGAGG No data
905856792_905856797 3 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856797 1:41319860-41319882 AGGTCACTGAAATCCAGAGGTGG No data
905856792_905856796 0 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856796 1:41319857-41319879 AAGAGGTCACTGAAATCCAGAGG No data
905856792_905856799 5 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856799 1:41319862-41319884 GTCACTGAAATCCAGAGGTGGGG No data
905856792_905856801 9 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856801 1:41319866-41319888 CTGAAATCCAGAGGTGGGGAGGG No data
905856792_905856798 4 Left 905856792 1:41319834-41319856 CCCTCCTCATTTTTCATTTACAG No data
Right 905856798 1:41319861-41319883 GGTCACTGAAATCCAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905856792 Original CRISPR CTGTAAATGAAAAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr