ID: 905858001

View in Genome Browser
Species Human (GRCh38)
Location 1:41327564-41327586
Sequence CCCAATCCTGCAACCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905858001_905858007 23 Left 905858001 1:41327564-41327586 CCAGCAGGGGTTGCAGGATTGGG No data
Right 905858007 1:41327610-41327632 CTGTAAAATGTTCACCTTTCAGG No data
905858001_905858008 24 Left 905858001 1:41327564-41327586 CCAGCAGGGGTTGCAGGATTGGG No data
Right 905858008 1:41327611-41327633 TGTAAAATGTTCACCTTTCAGGG No data
905858001_905858005 -8 Left 905858001 1:41327564-41327586 CCAGCAGGGGTTGCAGGATTGGG No data
Right 905858005 1:41327579-41327601 GGATTGGGGGAAGCCACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905858001 Original CRISPR CCCAATCCTGCAACCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr