ID: 905861286

View in Genome Browser
Species Human (GRCh38)
Location 1:41353718-41353740
Sequence CAAGGTCACCAAGTTACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861279_905861286 27 Left 905861279 1:41353668-41353690 CCAGTGTTGTCTTACTGCTAAGG No data
Right 905861286 1:41353718-41353740 CAAGGTCACCAAGTTACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905861286 Original CRISPR CAAGGTCACCAAGTTACAGC CGG Intergenic
No off target data available for this crispr