ID: 905861447

View in Genome Browser
Species Human (GRCh38)
Location 1:41354720-41354742
Sequence AAGTCTATGAACCAGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861447_905861457 19 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861457 1:41354762-41354784 CACATGACAGAAGGGGCAGGGGG No data
905861447_905861459 30 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861459 1:41354773-41354795 AGGGGCAGGGGGTCTCTCTAGGG No data
905861447_905861450 11 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861450 1:41354754-41354776 TCCAACCTCACATGACAGAAGGG No data
905861447_905861455 17 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG No data
905861447_905861449 10 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861449 1:41354753-41354775 GTCCAACCTCACATGACAGAAGG No data
905861447_905861454 16 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861454 1:41354759-41354781 CCTCACATGACAGAAGGGGCAGG No data
905861447_905861458 29 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861458 1:41354772-41354794 AAGGGGCAGGGGGTCTCTCTAGG No data
905861447_905861456 18 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861456 1:41354761-41354783 TCACATGACAGAAGGGGCAGGGG No data
905861447_905861452 12 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861452 1:41354755-41354777 CCAACCTCACATGACAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905861447 Original CRISPR AAGTCTATGAACCAGAATAC AGG (reversed) Intergenic