ID: 905861452

View in Genome Browser
Species Human (GRCh38)
Location 1:41354755-41354777
Sequence CCAACCTCACATGACAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861447_905861452 12 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861452 1:41354755-41354777 CCAACCTCACATGACAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905861452 Original CRISPR CCAACCTCACATGACAGAAG GGG Intergenic
No off target data available for this crispr