ID: 905861455

View in Genome Browser
Species Human (GRCh38)
Location 1:41354760-41354782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861447_905861455 17 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type