ID: 905861459

View in Genome Browser
Species Human (GRCh38)
Location 1:41354773-41354795
Sequence AGGGGCAGGGGGTCTCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861453_905861459 -9 Left 905861453 1:41354759-41354781 CCTCACATGACAGAAGGGGCAGG No data
Right 905861459 1:41354773-41354795 AGGGGCAGGGGGTCTCTCTAGGG No data
905861447_905861459 30 Left 905861447 1:41354720-41354742 CCTGTATTCTGGTTCATAGACTT No data
Right 905861459 1:41354773-41354795 AGGGGCAGGGGGTCTCTCTAGGG No data
905861451_905861459 -5 Left 905861451 1:41354755-41354777 CCAACCTCACATGACAGAAGGGG No data
Right 905861459 1:41354773-41354795 AGGGGCAGGGGGTCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905861459 Original CRISPR AGGGGCAGGGGGTCTCTCTA GGG Intergenic
No off target data available for this crispr