ID: 905861533

View in Genome Browser
Species Human (GRCh38)
Location 1:41355235-41355257
Sequence AGTTGAGGAGGTGGTGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905861523_905861533 18 Left 905861523 1:41355194-41355216 CCAGGGTTCCCTGTGTGGTGGGG No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861525_905861533 10 Left 905861525 1:41355202-41355224 CCCTGTGTGGTGGGGCCCTGAGA No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861526_905861533 9 Left 905861526 1:41355203-41355225 CCTGTGTGGTGGGGCCCTGAGAC No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861528_905861533 -6 Left 905861528 1:41355218-41355240 CCTGAGACCAACAGTCAAGTTGA No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861519_905861533 26 Left 905861519 1:41355186-41355208 CCTCTCTACCAGGGTTCCCTGTG No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861527_905861533 -5 Left 905861527 1:41355217-41355239 CCCTGAGACCAACAGTCAAGTTG No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data
905861518_905861533 30 Left 905861518 1:41355182-41355204 CCAGCCTCTCTACCAGGGTTCCC No data
Right 905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905861533 Original CRISPR AGTTGAGGAGGTGGTGACGC TGG Intergenic
No off target data available for this crispr