ID: 905862548

View in Genome Browser
Species Human (GRCh38)
Location 1:41361203-41361225
Sequence CTCCGCGCCGAGCAGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905862533_905862548 -7 Left 905862533 1:41361187-41361209 CCCCTAGCCCCCCCGCCTCCGCG 0: 1
1: 0
2: 4
3: 21
4: 384
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862535_905862548 -9 Left 905862535 1:41361189-41361211 CCTAGCCCCCCCGCCTCCGCGCC 0: 1
1: 0
2: 13
3: 126
4: 1086
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862526_905862548 28 Left 905862526 1:41361152-41361174 CCAGCCGCGGACCAATGGGAGTG 0: 1
1: 0
2: 1
3: 2
4: 44
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862530_905862548 17 Left 905862530 1:41361163-41361185 CCAATGGGAGTGTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 47
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862527_905862548 24 Left 905862527 1:41361156-41361178 CCGCGGACCAATGGGAGTGTTAG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862532_905862548 -6 Left 905862532 1:41361186-41361208 CCCCCTAGCCCCCCCGCCTCCGC 0: 1
1: 0
2: 0
3: 61
4: 823
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862534_905862548 -8 Left 905862534 1:41361188-41361210 CCCTAGCCCCCCCGCCTCCGCGC 0: 1
1: 0
2: 4
3: 33
4: 332
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225
905862531_905862548 -3 Left 905862531 1:41361183-41361205 CCGCCCCCTAGCCCCCCCGCCTC 0: 1
1: 0
2: 9
3: 235
4: 2615
Right 905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905862548 Original CRISPR CTCCGCGCCGAGCAGGGGGC GGG Intergenic
900019987 1:181564-181586 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
900393442 1:2443653-2443675 CTCCGCGGCGGGCACCGGGCTGG - Intronic
900521132 1:3106047-3106069 CTCAGGGCTGAGAAGGGGGCAGG + Intronic
900605885 1:3523369-3523391 CACAGGGCTGAGCAGGGGGCTGG - Intronic
901066591 1:6497332-6497354 CCCCGTGCCGCGCGGGGGGCGGG + Intronic
901086359 1:6614250-6614272 CGCGGGCCCGAGCAGGGGGCGGG - Intronic
901506814 1:9690125-9690147 CTCCGTCCCGAATAGGGGGCAGG - Intronic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
905390975 1:37635037-37635059 CTGCGCTCCGAGCGCGGGGCTGG + Intergenic
905448341 1:38042100-38042122 CTCTGGGCCGCGCAGGCGGCGGG + Intergenic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
909392948 1:75136521-75136543 CCCCGCGCCGAGGCTGGGGCGGG + Intronic
915592907 1:156880640-156880662 CTGCGAGCCAAGCAGGGGGTGGG - Intronic
916991602 1:170250870-170250892 CTCCCTGCAGAGCAGGGGTCGGG - Intergenic
921432776 1:215082953-215082975 CGCCGCGCCGTGCCGGGGCCGGG + Intronic
923562963 1:235055450-235055472 CTGCACGCCGAGGAGGGGCCTGG - Intergenic
924313755 1:242774499-242774521 CTCCCCGCAGGGCAGGGGTCTGG - Intergenic
1062774641 10:135343-135365 CTTCGCGCGGAGCCGGCGGCGGG + Intronic
1063442772 10:6086490-6086512 CTCAGCGCCTGGCAGGAGGCTGG - Intergenic
1065099498 10:22320548-22320570 CTCCGCGCCGGGCCGGGACCGGG - Intronic
1069742027 10:70690908-70690930 CTCAGGGCCAAGCAGGGGCCAGG + Intronic
1070773528 10:79096717-79096739 CCCAGAGCCTAGCAGGGGGCTGG - Intronic
1072730612 10:97843623-97843645 CTCCGTGCCAAGCATGGAGCTGG - Intergenic
1072783995 10:98268245-98268267 CTCCGCGGCCAGCTCGGGGCTGG - Exonic
1073059370 10:100724316-100724338 GTCCGCCCCGCGCAGTGGGCAGG - Intergenic
1073578317 10:104642441-104642463 CCCCGAGGCGAGCAGGAGGCTGG - Intronic
1074190213 10:111128911-111128933 CTCAGGGCGGAGCAGGGGGCAGG - Intergenic
1075438628 10:122462305-122462327 CTTCGCGCCCAGCCCGGGGCCGG + Intronic
1075664478 10:124220963-124220985 CTCCTCCATGAGCAGGGGGCTGG - Intergenic
1077331612 11:1986485-1986507 CTCGGAGCCGAGCAGGGGCTGGG + Intergenic
1078382632 11:10858151-10858173 ATCCGCGCTGAGCAGCGGGGCGG + Intronic
1082817046 11:57515744-57515766 CTGCGCCCCGAGGTGGGGGCGGG + Exonic
1083592262 11:63902730-63902752 CTCCAGACCGGGCAGGGGGCTGG - Exonic
1083771634 11:64870932-64870954 CTCAGGGACGAGAAGGGGGCCGG - Intronic
1084070061 11:66728150-66728172 CTCCGCGCCGAGGTAGGTGCCGG - Intronic
1084171287 11:67401994-67402016 CTCGGCGGCGGGCTGGGGGCGGG + Intronic
1084276374 11:68053158-68053180 CTCCAGGCAGAGCAGAGGGCAGG + Exonic
1085346000 11:75768604-75768626 ATCCGCGCGGAGCAGGCTGCTGG + Intronic
1085982784 11:81744657-81744679 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1089491695 11:118887960-118887982 CTCAGCCCCAAGGAGGGGGCAGG - Intronic
1089537403 11:119169087-119169109 GGCCGCGCTGAGCGGGGGGCAGG + Exonic
1091259689 11:134224652-134224674 CTCCGGGCGGGGGAGGGGGCGGG - Exonic
1091261084 11:134234825-134234847 CACCGGGCCGAGTAGGGGGCTGG - Intronic
1202814593 11_KI270721v1_random:41661-41683 CTCGGAGCCGAGCAGGGGCTGGG + Intergenic
1091373367 12:11178-11200 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
1092204281 12:6606330-6606352 CTGCCCGCCGAGCAGGGGGACGG + Exonic
1093435250 12:19129484-19129506 CTTCGCGCGGCGGAGGGGGCGGG + Intergenic
1093728703 12:22544200-22544222 GTCTGCGCCGAGCGCGGGGCCGG + Intronic
1094624116 12:32106787-32106809 GGCGGCTCCGAGCAGGGGGCGGG - Intergenic
1095977550 12:47950058-47950080 CCTCACGCCGAGCAGGGGGCCGG + Intergenic
1096122009 12:49094425-49094447 CTGCGGGCCGGGCCGGGGGCCGG - Exonic
1100391724 12:94150040-94150062 CTCCGCGGCGCCCCGGGGGCAGG - Intronic
1102429890 12:112875119-112875141 CTCTGCACCGAGCCTGGGGCAGG - Exonic
1104001567 12:124863757-124863779 CTCCGCGCCTGGCAGGAGACGGG + Exonic
1104020560 12:124989211-124989233 AGCCGGGCCGGGCAGGGGGCGGG + Intergenic
1105691836 13:22848643-22848665 GTTCTCGCCGAGCAGGGGGCGGG + Intergenic
1105943408 13:25170688-25170710 CGGCGCGCCGAGCCGGGGCCCGG - Exonic
1106602674 13:31200601-31200623 CCCCGCGCCGGGCGGGAGGCTGG + Intronic
1108196604 13:48001420-48001442 CTCCGCGCCCGCCAGGGAGCTGG - Intergenic
1109124902 13:58505561-58505583 CTCCCCGCGGAGCAGGGCTCAGG - Intergenic
1109858833 13:68171148-68171170 CTCCGCGCGGGGCAGGGCGCGGG + Intergenic
1110775659 13:79405845-79405867 CGGCGCGCGGAGGAGGGGGCGGG - Exonic
1110854181 13:80278783-80278805 CTCCCCGCGGGGCAGGGGTCAGG - Intergenic
1112567609 13:100564809-100564831 CTATGCCCCGGGCAGGGGGCGGG + Intronic
1113914705 13:113863472-113863494 CGCCGCGCGGAGCTGGGGGGCGG + Intronic
1118806057 14:69237799-69237821 CTCCGCGTTGAGCAGGGCCCTGG - Exonic
1119764840 14:77181848-77181870 CTGAGCGCCGAGCCTGGGGCTGG + Exonic
1121350638 14:93170248-93170270 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1122077736 14:99246572-99246594 GTCCGCGCCGTGCCGGGTGCGGG + Intronic
1122131183 14:99605082-99605104 CGCCGCTCCGGGCAGGGGGCAGG - Intergenic
1122470380 14:101962189-101962211 CTCTGGGCAGGGCAGGGGGCAGG - Intergenic
1124024988 15:25957760-25957782 CTCAGTGCTGCGCAGGGGGCAGG - Intergenic
1128344006 15:66842496-66842518 CTGCGAGCCGAGCACGGGACCGG + Intergenic
1129273868 15:74433205-74433227 CTCCGGGCCGGGGCGGGGGCGGG + Intronic
1129852265 15:78800246-78800268 CACCTCGCCAAGCAGGTGGCAGG + Exonic
1130224263 15:82045733-82045755 CTCGCCGCCGAGCCGAGGGCCGG - Exonic
1130250734 15:82298827-82298849 CACCTCGCCAAGCAGGTGGCAGG - Intergenic
1131431713 15:92393787-92393809 CTGCGCGCGGAGCCGGGCGCGGG + Intergenic
1132583030 16:694070-694092 CCCCGCCCCGGGCAGGGGGGCGG - Exonic
1132689120 16:1174649-1174671 CTCCTCTCCCAGCTGGGGGCTGG - Intronic
1132748509 16:1446838-1446860 CCCCGAGCTGAGCACGGGGCTGG + Intronic
1132766044 16:1534651-1534673 CTCAGGGCAGAGCAGGGGCCAGG - Intronic
1132804748 16:1770204-1770226 CTCCGGGCTGAGCAGTGGGGCGG + Exonic
1133273766 16:4624806-4624828 CCCCGGGCCGAGCCGGGGGTGGG + Exonic
1136458446 16:30395461-30395483 CTCCGCGCCAAGCCGGGAGCGGG - Exonic
1136550369 16:30979566-30979588 GCCCGCGCCGGGCAGGGGTCAGG - Exonic
1138291354 16:55849806-55849828 TGCAGCGCGGAGCAGGGGGCTGG + Intronic
1138453254 16:57106195-57106217 CTCCTCCCCGAGCCAGGGGCAGG - Intronic
1139600308 16:67982453-67982475 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1141715614 16:85725114-85725136 CTCTGCCCTGGGCAGGGGGCGGG + Intronic
1141835566 16:86536789-86536811 CTCTGTGCGGAGCAGGGGGAGGG - Intronic
1142011059 16:87714377-87714399 CTCCGCTCCGGGCAGGGTGCAGG + Intronic
1142018642 16:87766133-87766155 CACCGCGCCCAGCCCGGGGCCGG - Intergenic
1143183571 17:4998145-4998167 CGCCGCGCCGAGGTGAGGGCTGG + Exonic
1143446871 17:7014951-7014973 TTCCGCCCCGGGCGGGGGGCGGG + Intronic
1145915424 17:28571236-28571258 CTCCGCGTCGGGGATGGGGCCGG - Intronic
1145962819 17:28897411-28897433 CACCGCGCGGCGCAGGGCGCTGG - Intronic
1148326940 17:46788844-46788866 CTCCACGGCGAGCTGAGGGCAGG + Intronic
1148451124 17:47778414-47778436 GTCCGCGCCGCTCAGGGCGCAGG - Intergenic
1148911240 17:50944312-50944334 CTCCGCGCCAAGCCTGGGGGTGG - Intergenic
1150488767 17:65560887-65560909 CCGCGAGCCGAGCCGGGGGCCGG - Intronic
1151964361 17:77423633-77423655 CTCCGCGCGGAGCCGGGGAAGGG - Intronic
1152557956 17:81063962-81063984 CTCCCGGCCAAGCAAGGGGCTGG - Intronic
1152751719 17:82065442-82065464 CTCCGCGCCGGGCCAGGGGAAGG + Exonic
1157718498 18:49905853-49905875 CTCGGGGTCGAGCTGGGGGCAGG + Intronic
1158448943 18:57546401-57546423 CTACACTCTGAGCAGGGGGCAGG + Intergenic
1158530522 18:58256170-58256192 CTCCGCGCAGTCCACGGGGCCGG - Intronic
1160535051 18:79587163-79587185 CTCAGCACCAAGCAGGGGTCAGG + Intergenic
1160567767 18:79797950-79797972 CTCCGCCCCGAGGAGGCCGCCGG + Intergenic
1160720448 19:594814-594836 CTCCACGCAGACCAGAGGGCAGG - Intronic
1160810509 19:1011066-1011088 CTGGGCGGCAAGCAGGGGGCAGG - Intronic
1160887042 19:1354963-1354985 CTCCCCGCGGGGCCGGGGGCGGG - Intronic
1160960545 19:1718816-1718838 CCCCGCGGAGAGCAGGGGGGCGG - Intergenic
1162176384 19:8832872-8832894 CTCCGGGCCGGGCGGAGGGCGGG + Intronic
1162745134 19:12793728-12793750 CGCGGCGCCGGGAAGGGGGCCGG + Intronic
1162909900 19:13842972-13842994 CCCCGGGCCGGGCAGGGGGCGGG + Intergenic
1162987123 19:14277836-14277858 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1163085988 19:14979905-14979927 CGCGGCTCCGAGCAGGGGGCGGG - Intronic
1165757963 19:38305051-38305073 CCCAGCGCTGGGCAGGGGGCAGG - Intergenic
1165958210 19:39515234-39515256 GTCCGCGCCGAGGAGGGGGCTGG - Exonic
1166139528 19:40798834-40798856 CCCCGCGCTGGGCGGGGGGCGGG + Intronic
1166361209 19:42253753-42253775 CCACCCGCCGAGCAGGGGGATGG + Intronic
1166471692 19:43083912-43083934 CCCCGCGCGGTGCAGCGGGCAGG + Intronic
1166984184 19:46649697-46649719 CGCCACGGCGTGCAGGGGGCTGG + Exonic
1167292996 19:48634884-48634906 CTCCCCGGAGAGCAGGGGGTTGG - Intronic
1167356402 19:49006864-49006886 CTCCGAGCTGAGCAGAGCGCTGG - Intronic
1167650348 19:50725298-50725320 CTGGGCGCCGAGCTCGGGGCGGG - Exonic
926292168 2:11539886-11539908 CTCCCTGCCGGGCAGGGGCCAGG + Intronic
926474762 2:13308465-13308487 CTCCCCGCCGGGCAGGGCTCAGG - Intergenic
929936569 2:46297948-46297970 GTCCGGGCCGATCAGGGGGCCGG + Intronic
932627263 2:73307817-73307839 CTCCGCGCTGAGCAGGAGCTGGG + Intergenic
935698107 2:105787209-105787231 CTCAGCGCCGTGGAAGGGGCAGG + Intronic
937231557 2:120400917-120400939 ATCAGCGCCGAGCAGGGGTGAGG - Intergenic
942170229 2:173282719-173282741 CTCCGCGCGGGGCAGGGCTCGGG - Intergenic
943906103 2:193502583-193502605 CTCCCCGCCGGGCAGGGCTCCGG - Intergenic
944252467 2:197591688-197591710 CTCCCCGCCGGGCAGGGCTCAGG - Intronic
944428047 2:199604035-199604057 CTCCGCTCCCAGCACTGGGCTGG - Intergenic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
948700046 2:239753684-239753706 CTCCAGGCCAAGCAGGAGGCAGG + Intergenic
948828760 2:240587100-240587122 CTCCGCTCCTCGCAGGGAGCGGG + Intronic
1169496757 20:6122995-6123017 CGCCGCGCCAGGCTGGGGGCAGG - Exonic
1170026197 20:11891368-11891390 CTCGGCGCCTAGCAGGTGGCGGG + Intronic
1171473526 20:25390484-25390506 CTTCGCGCGGAGCGGGGGGGGGG - Intronic
1171778379 20:29393267-29393289 CTCGGCCCCGAGGAAGGGGCTGG + Intergenic
1174180687 20:48672513-48672535 CTCCGAGCCGGGCAGGGGTCTGG + Intronic
1175199161 20:57266292-57266314 GCCAGCACCGAGCAGGGGGCGGG - Exonic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1176075057 20:63244606-63244628 CTCCGGGCAGAGTTGGGGGCTGG + Intronic
1176125145 20:63471844-63471866 CTCTGCGCCGAACAAAGGGCCGG - Intronic
1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG + Intronic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1176304929 21:5118345-5118367 CTCCGGGCCCAGCGGGGGGAGGG - Intronic
1179674938 21:42974817-42974839 CGCCGCCCGGGGCAGGGGGCGGG + Intronic
1179783880 21:43719079-43719101 TTCCGCGCGGCGCCGGGGGCTGG - Intronic
1179852125 21:44143685-44143707 CTCCGGGCCCAGCGGGGGGAGGG + Intronic
1179985955 21:44920467-44920489 CTCCGGGCTGGGCAGGAGGCAGG - Intronic
1182107789 22:27701619-27701641 CTCTGTGCAGAGCAGGGTGCTGG - Intergenic
1183546363 22:38456228-38456250 CTCCGAGCCGGGAAGGGGGGTGG + Intergenic
1183833992 22:40436935-40436957 CTCCACCCCCAGCGGGGGGCTGG + Intronic
1184101483 22:42343682-42343704 CGCCGCGCCGGGTGGGGGGCGGG + Intergenic
1184158157 22:42682459-42682481 CTCCCACCCAAGCAGGGGGCCGG - Intergenic
1185006478 22:48279644-48279666 CTCTCCGCCTAGCAGAGGGCTGG + Intergenic
1185317681 22:50186018-50186040 CCCAGCACCGAGCGGGGGGCGGG + Intronic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
953744950 3:45567102-45567124 CTAGGCGCCGAGCTGGTGGCAGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
963081866 3:141402295-141402317 CTCTGCCCCGCGCCGGGGGCGGG + Intronic
964774078 3:160256099-160256121 CTCTGGGCGGAGGAGGGGGCTGG + Intronic
965519997 3:169662224-169662246 CTCCGCGCCGGGCAGGCAGGGGG + Intronic
973681745 4:53327556-53327578 CTCCATGCAGAGCATGGGGCAGG + Intronic
973774257 4:54230675-54230697 CCCCGCGCGGAGAAGGGTGCCGG - Intronic
985629905 5:1008904-1008926 CTCCACGCCGCGCGGGGGCCGGG - Exonic
985896247 5:2751438-2751460 CGTCACGCCGAGCAGCGGGCAGG + Exonic
985913018 5:2897659-2897681 CTCCGCCCCCAGGAGGGGCCCGG + Intergenic
986131873 5:4939606-4939628 CTCCCTGCAGAGCAGAGGGCGGG + Intergenic
987476668 5:18399802-18399824 CTTCCCGCCGGGCAGGGGGCAGG - Intergenic
990984075 5:61626010-61626032 CTCCGCCTCGAGGAGGCGGCGGG + Intergenic
991371683 5:65925977-65925999 CCCCGAGACGCGCAGGGGGCGGG - Intergenic
994075666 5:95646827-95646849 GTTCTCGCCGCGCAGGGGGCGGG + Intronic
1002139854 5:177132365-177132387 GTGCGCGCCGGGCTGGGGGCCGG - Intergenic
1002439080 5:179254892-179254914 CTCAGTGCCCAGCAGGGCGCTGG + Intronic
1004883720 6:20032558-20032580 CTCCCCGCCGGGCAGGGCTCCGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006366747 6:33620859-33620881 CTCCGCGCCCAGCTGAGAGCAGG - Exonic
1008945242 6:57090005-57090027 CCCCGCGCCGCGCAGGATGCTGG - Exonic
1013155744 6:107490068-107490090 CCGCGAGCCGAGCCGGGGGCGGG - Exonic
1013225777 6:108118584-108118606 CTCCGGGCCCCGCAGGCGGCTGG - Intronic
1016330539 6:142947581-142947603 CTCCGCCCCGGGCAGGGCGGCGG - Intergenic
1017899483 6:158706579-158706601 GTCCTCGTCCAGCAGGGGGCTGG - Intronic
1018639640 6:165894637-165894659 CTTCCCACCGAGCATGGGGCTGG + Intronic
1018710963 6:166497941-166497963 CTCCCAGCTGGGCAGGGGGCTGG - Intronic
1019198456 6:170295975-170295997 CGCGGCGCAGAGGAGGGGGCGGG - Intronic
1019471738 7:1224764-1224786 CTCCACTCCGTGCAGGGGGTGGG + Intergenic
1022009094 7:26292986-26293008 CTCCTCTCCCAGGAGGGGGCTGG + Intronic
1023810355 7:43906630-43906652 CTCGGCGCCGGGGAGGGGCCTGG + Exonic
1026360807 7:69599527-69599549 CTCCGCCCCGAGGAGGGCGCGGG - Exonic
1026911647 7:74094763-74094785 CTCGGTGCACAGCAGGGGGCCGG - Intronic
1029423601 7:100483945-100483967 CTCCGCCCGGAGCAGGAGGAGGG - Exonic
1029513149 7:101009357-101009379 CCCAGCACCCAGCAGGGGGCTGG - Intronic
1030121155 7:106112092-106112114 CGCCGCGCCGAGCGGCAGGCGGG + Intronic
1030300219 7:107967020-107967042 CTCAGCACCCAGCAGGTGGCTGG + Intronic
1033672952 7:143510983-143511005 CGCCGCCCTGAGCAGGGTGCTGG - Intergenic
1034339021 7:150340684-150340706 CTCCCCCCAGAGCAGGGCGCGGG - Exonic
1034428571 7:151028279-151028301 CTCCGCCCAGAGCAGGGGGCGGG + Intergenic
1034475114 7:151277112-151277134 CCGAGCGCCGAGCAGGGAGCGGG - Intronic
1035051933 7:156003985-156004007 CTGCGCTCCCAGCAGGGGCCCGG + Intergenic
1035391622 7:158508226-158508248 CCCCACGCTGGGCAGGGGGCAGG + Intronic
1037584276 8:20265791-20265813 CTCTGCGCAGAGCAGGGAGATGG - Intronic
1037601151 8:20395281-20395303 CTCCAAGCAGAGCAGGTGGCAGG - Intergenic
1037799612 8:22025224-22025246 CTCCGGGCAGAGAAGCGGGCTGG - Exonic
1037876674 8:22551999-22552021 TTCCCCGGCGAGCAGGTGGCTGG - Exonic
1042155591 8:65841594-65841616 CTCCGGGCCGAGACGGGGGCAGG + Exonic
1043463838 8:80486518-80486540 TCCCGCGCGGAGAAGGGGGCGGG - Exonic
1046271151 8:111899160-111899182 CTCCCCGCCCAGCAGGTGCCTGG + Intergenic
1048202884 8:132391476-132391498 CTCTGCACCCAGCAGGTGGCCGG + Intronic
1048980795 8:139702623-139702645 CGCCGCGCCGGGCTGGGTGCAGG - Intronic
1049180763 8:141220877-141220899 CTCCGCGCCCAGCAGGCGCCAGG + Intronic
1049455062 8:142682502-142682524 CCCCGCACCCAGCAGGGGACAGG + Exonic
1049726289 8:144148019-144148041 CTTCCCGCCCAGCAGGGGCCCGG - Intronic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049883075 9:11152-11174 CACGGCGCCGGGCTGGGGGCGGG + Intergenic
1049988122 9:970848-970870 CACCGCGACAAGCAGGCGGCTGG + Intergenic
1050304904 9:4297925-4297947 CTCGGCGCGGAGCTAGGGGCGGG + Intronic
1052246861 9:26346913-26346935 CTCCGGACAGAGCAGTGGGCAGG - Intergenic
1053129059 9:35605243-35605265 CTCCGCGGCCTGCCGGGGGCGGG - Intergenic
1053312338 9:37027629-37027651 GTGCGCGCCGAGCAGGCGGAGGG - Intronic
1057259684 9:93576701-93576723 GTCCGGGCCGGGCCGGGGGCCGG - Exonic
1057313445 9:93955232-93955254 CGCCGCCCCGAGCTGCGGGCCGG - Exonic
1058908262 9:109498366-109498388 CCGCGCGCCGGGCGGGGGGCGGG + Intergenic
1059102373 9:111483439-111483461 CGCCGCGCGGTGCCGGGGGCCGG - Intronic
1059375407 9:113876653-113876675 CTCCGGTCCGAGCCCGGGGCCGG - Intronic
1060728296 9:126020852-126020874 CACCGCGCCCTGCAGGGGACTGG + Intergenic
1061037365 9:128121118-128121140 CCCCGCGCAGAGCAGAGGGAAGG - Exonic
1061166057 9:128922657-128922679 CGCAGCGCCCAGGAGGGGGCGGG + Intronic
1061252806 9:129436566-129436588 CTCTGCGGGGAGCGGGGGGCGGG - Intergenic
1061365788 9:130172097-130172119 CTCCCCGCCGCGGCGGGGGCCGG + Intergenic
1061754327 9:132802303-132802325 CTCCTCCCAGGGCAGGGGGCGGG + Intronic
1061922231 9:133788533-133788555 CTCTGCTCCGAGGAGGCGGCAGG + Intronic
1062536947 9:137025273-137025295 CTCCTCCCTGAGCTGGGGGCTGG - Intronic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1185483885 X:467910-467932 CTCCGCGCCCAGCCGGGTTCTGG + Intergenic
1187154664 X:16712171-16712193 CTCAGCGCTGGGCAGGGAGCCGG + Exonic
1187500169 X:19832837-19832859 GTCCTCTCCGAGCAGGGGGAGGG + Intronic
1188881823 X:35499464-35499486 CTCCCCGCCGGGCAGGGATCAGG + Intergenic
1192533778 X:71911326-71911348 CTCCGGGCCAAGCAGGCGGCAGG - Intergenic
1200402726 X:156028989-156029011 CACGGCGCCGGGCTGGGGGCGGG - Intergenic
1200829096 Y:7673317-7673339 CTCCCCGCAGAGCAGGGCTCGGG + Intergenic