ID: 905865729

View in Genome Browser
Species Human (GRCh38)
Location 1:41375593-41375615
Sequence GTCCCCACCATGGCTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905865729_905865736 2 Left 905865729 1:41375593-41375615 CCCTCTGTAGCCATGGTGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 905865736 1:41375618-41375640 AACAGGAGGCAGGGCAATAGTGG 0: 1
1: 0
2: 15
3: 139
4: 571
905865729_905865734 -8 Left 905865729 1:41375593-41375615 CCCTCTGTAGCCATGGTGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 905865734 1:41375608-41375630 GTGGGGACAGAACAGGAGGCAGG 0: 1
1: 1
2: 6
3: 64
4: 602
905865729_905865738 15 Left 905865729 1:41375593-41375615 CCCTCTGTAGCCATGGTGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 905865738 1:41375631-41375653 GCAATAGTGGAGTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 120
905865729_905865737 10 Left 905865729 1:41375593-41375615 CCCTCTGTAGCCATGGTGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 905865737 1:41375626-41375648 GCAGGGCAATAGTGGAGTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 115
905865729_905865735 -7 Left 905865729 1:41375593-41375615 CCCTCTGTAGCCATGGTGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 905865735 1:41375609-41375631 TGGGGACAGAACAGGAGGCAGGG 0: 1
1: 0
2: 11
3: 67
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905865729 Original CRISPR GTCCCCACCATGGCTACAGA GGG (reversed) Intronic
902810713 1:18886337-18886359 CTACCCACCATGGCCAAAGAAGG + Intronic
902923881 1:19683106-19683128 GTCCATGCCATGGCTGCAGATGG + Exonic
905112729 1:35608790-35608812 GTCCCCAGCATGACAACTGAAGG - Intronic
905865729 1:41375593-41375615 GTCCCCACCATGGCTACAGAGGG - Intronic
918584138 1:186166267-186166289 GGCCTCACCATAGCTGCAGATGG + Exonic
918691121 1:187480496-187480518 GTGCCCAACATGGCTCCAGCTGG + Intergenic
922093152 1:222416848-222416870 TTCCCCTTCATGACTACAGATGG - Intergenic
922687754 1:227659416-227659438 GTTCACACCATGGCCAGAGATGG + Exonic
1064638968 10:17396403-17396425 GTTCCCTCCATGGCTACACTAGG + Intronic
1066508230 10:36066827-36066849 GCCCCAACCATGGCTACCCATGG + Intergenic
1070479551 10:76869029-76869051 ATCCCCAACAGGGCAACAGATGG - Intergenic
1070615020 10:77962837-77962859 GCCCCTCCCATGGCTAGAGATGG - Intergenic
1072472738 10:95728740-95728762 CTCCCCACAATGGCAACAGAAGG + Intronic
1075442729 10:122492800-122492822 GTCCACTCCTTGGCCACAGAGGG - Intronic
1075715123 10:124551336-124551358 GTCACCACCAAGGATGCAGAGGG - Intronic
1077333990 11:1995214-1995236 CTCCCCACCAGGGCTTCAGCAGG - Intergenic
1079771790 11:24471106-24471128 GTTCCCTCTATGGCTTCAGAAGG - Intergenic
1086002361 11:81998541-81998563 GTCCTCAGCATGGCTACAATTGG - Intergenic
1089163936 11:116460413-116460435 GGCCCCAAGATGGCTAAAGAAGG - Intergenic
1089361933 11:117896597-117896619 GTACCCACAAGGGCTGCAGATGG + Intergenic
1090421551 11:126578920-126578942 ATCCTCACCATGCCTAGAGATGG + Intronic
1091023240 11:132119744-132119766 TTCTGCACCAAGGCTACAGAAGG + Intronic
1202816973 11_KI270721v1_random:50396-50418 CTCCCCACCAGGGCTTCAGCAGG - Intergenic
1095536035 12:43248735-43248757 GTCACCACCACGGCTACCGAAGG + Intergenic
1096526768 12:52214686-52214708 GTGGCCTCCATGGCTGCAGAGGG - Intergenic
1096698973 12:53369765-53369787 GTCTCTAGCATGGCAACAGAGGG + Intergenic
1098536014 12:71594305-71594327 GTCCCCAACATGGTTACATTTGG - Intergenic
1098761835 12:74434820-74434842 ATCCCAACCATGGCTAAAAAGGG + Intergenic
1100348353 12:93754188-93754210 GTCCCAGCCATGGCTAAAAAGGG - Intronic
1101656162 12:106722025-106722047 GCCTGCACCATGGCTACAGATGG + Intronic
1103038164 12:117673144-117673166 TTACCAACCATGGCCACAGATGG + Intronic
1103742118 12:123097927-123097949 GTCCCCTGCATCACTACAGAGGG - Intronic
1104073063 12:125363323-125363345 GTACCCATCAGGGCTTCAGAAGG - Intronic
1104612102 12:130237216-130237238 GTGCCCACCATGTCTGCAGTGGG - Intergenic
1113736234 13:112680549-112680571 TTCCCCACCTTGTCCACAGAAGG - Intronic
1113877223 13:113601954-113601976 GTCCGCTACAGGGCTACAGAGGG - Intronic
1114710273 14:24770414-24770436 GTCACCACCAGGGCTCCTGAAGG + Intergenic
1118318424 14:64739296-64739318 TTCCCCACAATGGCTCTAGAAGG + Intronic
1119668056 14:76498843-76498865 GTGCCCACCCAGGCCACAGATGG - Intronic
1202917932 14_KI270723v1_random:2689-2711 ATCCCCACCAGGGCTCCAGGGGG + Intergenic
1202926691 14_KI270724v1_random:31894-31916 ATCCCCACCAGGGCTCCAGGGGG - Intergenic
1129251424 15:74311169-74311191 GTCCCTCCCAAGGCTAAAGATGG + Intronic
1129737903 15:77976033-77976055 GCCCCATCCATGGCTAGAGATGG - Intergenic
1129738872 15:77980224-77980246 GTCCCCACCCAGCCTAGAGACGG + Intergenic
1132731301 16:1363586-1363608 GTGCCCGCCATGGCCACAGGGGG + Exonic
1135607473 16:23836530-23836552 GTCCCCACCCTGGTCCCAGACGG + Intronic
1136297194 16:29310266-29310288 GGTCACACCATGGCTAGAGATGG - Intergenic
1136577916 16:31135232-31135254 GTACCCACCACTGCTCCAGAGGG + Intronic
1136687586 16:32004168-32004190 GTCCTCTCCAAGGCTAGAGAGGG - Intergenic
1136788197 16:32947719-32947741 GTCCTCTCCAAGGCTAGAGAGGG - Intergenic
1136881587 16:33906070-33906092 GTCCTCTCCAAGGCTAGAGAGGG + Intergenic
1137228852 16:46542281-46542303 GTCCCCATCATGACCACAAATGG - Intergenic
1141434631 16:83993009-83993031 GTCCCCACCATGGGGGCAGGTGG - Intronic
1142058745 16:88016368-88016390 GGTCACACCATGGCTAGAGATGG - Intronic
1203090426 16_KI270728v1_random:1209376-1209398 GTCCTCTCCAAGGCTAGAGAGGG - Intergenic
1144206345 17:12982272-12982294 CTCCCCATCATGCCCACAGATGG + Intronic
1146024333 17:29306567-29306589 CACCCCAGCATGGCAACAGAGGG + Intergenic
1147148570 17:38499837-38499859 GTCCCCTCCAAGGCTAAAGAAGG - Intronic
1148123033 17:45223380-45223402 ATCCTCAGCATGGCTCCAGAGGG + Intronic
1148406715 17:47422018-47422040 GTCCCCATCATGACCACAAATGG + Intronic
1151508871 17:74546229-74546251 GTCACCTCCAAGGCTAAAGAAGG - Intergenic
1152376542 17:79921524-79921546 GGCCCCAGCCTGGCTTCAGAGGG + Intergenic
1155056190 18:22185656-22185678 TTCCCCACAATGGCCACAGCAGG - Intronic
1157201591 18:45664302-45664324 CTCCCCACCATTGCCATAGATGG - Intronic
1160391391 18:78536210-78536232 CTCCCCACCATGGCTGCACATGG - Intergenic
1161428142 19:4215903-4215925 GTCCCCACCAAGACTCCAGTGGG - Intronic
1162666761 19:12220171-12220193 GGCACCAGCATGGCCACAGAGGG - Intergenic
1162890352 19:13728315-13728337 GTGCCCTCCATGGCTACACCTGG + Intergenic
1163548138 19:17951231-17951253 GTCCCCACCAAGGCTGAAGGTGG + Intergenic
1163562757 19:18030157-18030179 TTCCCCACCCTGGCTAGAGGTGG - Intergenic
1165320257 19:35080590-35080612 GTCCCCACACAGGCTGCAGAGGG - Intergenic
1165324196 19:35104663-35104685 GTCCCCGCCCAGGCCACAGAGGG - Intergenic
1166654263 19:44598836-44598858 ATGCCCACCATCTCTACAGAAGG - Intergenic
1167749400 19:51370799-51370821 CTCCCCTCCATGTCTACAGGGGG + Intergenic
925027443 2:621049-621071 GTCCCCACCGTGCATACAGTCGG + Intergenic
926945533 2:18183651-18183673 CTTCCCACCATGGCCAAAGAGGG - Intronic
927653259 2:24924941-24924963 GTCCCCTCCATGGCTGCATCTGG + Intergenic
934960681 2:98669732-98669754 GCCCCCACCATGGGCTCAGAAGG - Intronic
937640257 2:124203732-124203754 ATCCCAACCATGGCTAAAAAGGG - Intronic
943460031 2:188161269-188161291 GTGTCCATCATAGCTACAGATGG - Intergenic
946197115 2:218040278-218040300 GTCCCAACCATGTCTACATCTGG - Intronic
946923491 2:224603648-224603670 TTCCGCACCAGGGCTGCAGATGG + Intergenic
947886531 2:233576481-233576503 GCTCACACCATGGCTTCAGAAGG - Intergenic
947893451 2:233646121-233646143 GCTCACACCATGGCTTCAGAAGG - Intronic
948225810 2:236308557-236308579 GCCCCCACACTGGCCACAGAGGG - Intergenic
1170073209 20:12391322-12391344 CTCCCCACCATGCCCACAGTGGG + Intergenic
1170897179 20:20426029-20426051 GGCCCAGCCATGCCTACAGATGG - Intronic
1170969674 20:21105213-21105235 GTCCTGACCAGGGCTCCAGAGGG - Intergenic
1175677829 20:60961964-60961986 GGCCACATCATGGCTACAGGTGG + Intergenic
1176241911 20:64079342-64079364 GGCCCCACCCTGGCTGCCGAAGG + Exonic
1179713553 21:43276218-43276240 GTCCCCACCATAGAGACAGCAGG + Intergenic
1181101935 22:20546631-20546653 GTCCCCCCAAGGGCCACAGATGG + Intronic
1184409615 22:44318971-44318993 GTCCCCAGCGTGGCTAAGGATGG + Intergenic
1184993369 22:48185246-48185268 GGCCCCAGCATGGCTGCAGACGG + Intergenic
950043453 3:9934420-9934442 GTCCCCAGCCTGGGTAAAGATGG + Exonic
950425128 3:12921045-12921067 GTCTCAGCCATGGCTACTGAGGG + Intronic
950962849 3:17123532-17123554 GTCCTAACTATGGCTCCAGAAGG - Intergenic
953718675 3:45336724-45336746 GCCACCACCATGGCTAGAGAAGG + Intergenic
953860047 3:46536591-46536613 GTCTCAACCATGGCTGCACATGG + Intronic
957621906 3:82604709-82604731 GGACCCAGCATGGCCACAGAGGG + Intergenic
959063818 3:101637984-101638006 GACACCACCATGTTTACAGACGG + Intergenic
962853684 3:139326255-139326277 GTCCCCTCCATGGGCACACATGG + Intronic
965770138 3:172173504-172173526 CACCACACCATGCCTACAGAAGG - Intronic
969443887 4:7233290-7233312 GTCCCCACCGTGGCTTCTGCAGG - Intronic
973851503 4:54965769-54965791 GTCTCCTCCATGGTTACTGATGG + Intergenic
981348420 4:143700665-143700687 GCCCCCGCCATGGCCACGGATGG + Exonic
983645131 4:169981874-169981896 GTACTCACCATTGCTCCAGAAGG - Intergenic
986188659 5:5471807-5471829 CTTCCCACCATGGTTACAGCAGG - Intronic
990794496 5:59524783-59524805 GTCCCAACCATGGCTAAAAGGGG + Intronic
991410837 5:66343922-66343944 TTTCCCACCATGGCTTCATAAGG + Intergenic
992994406 5:82318313-82318335 GCCCCCACCATGTCCACAGTGGG + Exonic
994774993 5:104029342-104029364 GTCCCCAGAATGGCTACAATTGG + Intergenic
996658531 5:125970778-125970800 GTCTGCACCCTGGCTTCAGAGGG + Intergenic
997347702 5:133204060-133204082 GTCCCCACCCTGCCAACTGATGG - Intronic
998497687 5:142604947-142604969 CTCCATTCCATGGCTACAGATGG - Intronic
1002899217 6:1396530-1396552 GTCCCCAACATGGCTCGTGATGG - Intergenic
1003255584 6:4472127-4472149 GTCCTCACCATCACTACAAAAGG + Intergenic
1006778657 6:36616864-36616886 TTTCCCACTATGGCTGCAGAGGG - Intergenic
1009327943 6:62377234-62377256 GACCCTCCCATGGCTTCAGAAGG - Intergenic
1013338647 6:109191622-109191644 GTCCCAGCCATGGCTAAAAATGG + Intergenic
1016470541 6:144370313-144370335 GTCCCAGCCATGGCTACAAGGGG + Intronic
1017412415 6:154182793-154182815 GTCCCCATCATGGATCCACATGG - Intronic
1017925998 6:158912241-158912263 GGCCCCAGGATGGCAACAGATGG - Intergenic
1019358174 7:591786-591808 CTCCCCACAATGGCCCCAGATGG + Intronic
1019626489 7:2018548-2018570 GTCCACACCATGGACACAGAGGG + Intronic
1022300529 7:29098278-29098300 GTTCTAACCATGGCCACAGAGGG + Intronic
1022540765 7:31133583-31133605 GTCCTCTACTTGGCTACAGATGG + Intergenic
1023742219 7:43290823-43290845 GTCTCCACCATGACAACAGCTGG - Intronic
1026015089 7:66666215-66666237 GTCCCCTCCCCGGCTTCAGAGGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029710099 7:102294763-102294785 GGCCCCCACCTGGCTACAGATGG - Intronic
1034398129 7:150842880-150842902 TTCCCATCCATGGCTCCAGATGG + Intronic
1034861526 7:154599241-154599263 GGCCCCACAATGGGGACAGATGG + Intronic
1035281200 7:157779534-157779556 GTCCCCAGCAGGGCGACGGAGGG + Intronic
1038425070 8:27459623-27459645 GTCCCCTCCATGGCCACATGAGG + Intergenic
1044602390 8:94018538-94018560 GTCTCCACCATAGTTGCAGAAGG - Intergenic
1044788759 8:95824054-95824076 TCCCGCACCAGGGCTACAGATGG - Intergenic
1046906224 8:119576075-119576097 GTCCTGAATATGGCTACAGAGGG - Intronic
1047969904 8:130075539-130075561 GGGCCCACCTTGGATACAGACGG - Intronic
1048794526 8:138137787-138137809 GTCCCCACAATGCAGACAGAGGG + Intronic
1054746725 9:68861450-68861472 GTCTCCACCCTGGCAACAGAAGG - Intronic
1054981151 9:71208076-71208098 TTCCCCTCCAGGGCTAGAGATGG - Intronic
1059281061 9:113134593-113134615 GTCCCCACCCTGGGCACAAAAGG + Intergenic
1061582418 9:131545990-131546012 CTCCCCACCCTGGCTCCGGATGG - Intergenic
1062029439 9:134355637-134355659 GTCCTCAGCCTGGCTGCAGAGGG - Intronic
1062676735 9:137750696-137750718 GTCCCCACCACTACTCCAGAGGG - Intronic
1187279415 X:17846559-17846581 GTCCCCAGAATGGCTTCAAAAGG + Intronic
1187826479 X:23336259-23336281 GTCCCCATCAGGGATTCAGATGG - Intronic
1191910988 X:66149461-66149483 GTCATAACCATGGCTACAGAAGG + Intergenic
1195721560 X:107873540-107873562 GTCCCCAGGATGGCTACAATTGG - Intronic
1197819494 X:130530256-130530278 GTCATCACCATGGTTCCAGATGG - Intergenic
1197819791 X:130531295-130531317 ATCACCACCAGGGCTCCAGATGG - Intergenic