ID: 905869617

View in Genome Browser
Species Human (GRCh38)
Location 1:41395553-41395575
Sequence CGGCAGGGCTGGATGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869608_905869617 22 Left 905869608 1:41395508-41395530 CCCAGGAGTGTGTGTGTGTGTGT 0: 8
1: 173
2: 1231
3: 5294
4: 6076
Right 905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG No data
905869606_905869617 27 Left 905869606 1:41395503-41395525 CCAGCCCCAGGAGTGTGTGTGTG No data
Right 905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG No data
905869605_905869617 28 Left 905869605 1:41395502-41395524 CCCAGCCCCAGGAGTGTGTGTGT No data
Right 905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG No data
905869609_905869617 21 Left 905869609 1:41395509-41395531 CCAGGAGTGTGTGTGTGTGTGTG 0: 24
1: 497
2: 3131
3: 3774
4: 5653
Right 905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG No data
905869607_905869617 23 Left 905869607 1:41395507-41395529 CCCCAGGAGTGTGTGTGTGTGTG No data
Right 905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869617 Original CRISPR CGGCAGGGCTGGATGGAAGT GGG Intergenic
No off target data available for this crispr