ID: 905869820

View in Genome Browser
Species Human (GRCh38)
Location 1:41396797-41396819
Sequence GCCCAGGGCCTCCGTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869820_905869824 -10 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869824 1:41396810-41396832 GGCCCTGGGCCATGGGATCCTGG No data
905869820_905869835 18 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869835 1:41396838-41396860 CAGGGTTGGGGAGATCGAGCAGG No data
905869820_905869833 6 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869833 1:41396826-41396848 ATCCTGGGACATCAGGGTTGGGG No data
905869820_905869832 5 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869832 1:41396825-41396847 GATCCTGGGACATCAGGGTTGGG No data
905869820_905869825 -9 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869825 1:41396811-41396833 GCCCTGGGCCATGGGATCCTGGG No data
905869820_905869829 -1 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869829 1:41396819-41396841 CCATGGGATCCTGGGACATCAGG No data
905869820_905869830 0 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869830 1:41396820-41396842 CATGGGATCCTGGGACATCAGGG No data
905869820_905869831 4 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869831 1:41396824-41396846 GGATCCTGGGACATCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869820 Original CRISPR GCCCAGGGCCTCCGTGCAGG TGG (reversed) Intergenic
No off target data available for this crispr