ID: 905869824

View in Genome Browser
Species Human (GRCh38)
Location 1:41396810-41396832
Sequence GGCCCTGGGCCATGGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869820_905869824 -10 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869824 1:41396810-41396832 GGCCCTGGGCCATGGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869824 Original CRISPR GGCCCTGGGCCATGGGATCC TGG Intergenic
No off target data available for this crispr