ID: 905869825

View in Genome Browser
Species Human (GRCh38)
Location 1:41396811-41396833
Sequence GCCCTGGGCCATGGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869820_905869825 -9 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869825 1:41396811-41396833 GCCCTGGGCCATGGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869825 Original CRISPR GCCCTGGGCCATGGGATCCT GGG Intergenic
No off target data available for this crispr