ID: 905869830

View in Genome Browser
Species Human (GRCh38)
Location 1:41396820-41396842
Sequence CATGGGATCCTGGGACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869821_905869830 -3 Left 905869821 1:41396800-41396822 CCTGCACGGAGGCCCTGGGCCAT No data
Right 905869830 1:41396820-41396842 CATGGGATCCTGGGACATCAGGG No data
905869820_905869830 0 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869830 1:41396820-41396842 CATGGGATCCTGGGACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869830 Original CRISPR CATGGGATCCTGGGACATCA GGG Intergenic
No off target data available for this crispr