ID: 905869831

View in Genome Browser
Species Human (GRCh38)
Location 1:41396824-41396846
Sequence GGATCCTGGGACATCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869820_905869831 4 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869831 1:41396824-41396846 GGATCCTGGGACATCAGGGTTGG No data
905869821_905869831 1 Left 905869821 1:41396800-41396822 CCTGCACGGAGGCCCTGGGCCAT No data
Right 905869831 1:41396824-41396846 GGATCCTGGGACATCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869831 Original CRISPR GGATCCTGGGACATCAGGGT TGG Intergenic
No off target data available for this crispr