ID: 905869832

View in Genome Browser
Species Human (GRCh38)
Location 1:41396825-41396847
Sequence GATCCTGGGACATCAGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869821_905869832 2 Left 905869821 1:41396800-41396822 CCTGCACGGAGGCCCTGGGCCAT No data
Right 905869832 1:41396825-41396847 GATCCTGGGACATCAGGGTTGGG No data
905869826_905869832 -10 Left 905869826 1:41396812-41396834 CCCTGGGCCATGGGATCCTGGGA No data
Right 905869832 1:41396825-41396847 GATCCTGGGACATCAGGGTTGGG No data
905869820_905869832 5 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869832 1:41396825-41396847 GATCCTGGGACATCAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869832 Original CRISPR GATCCTGGGACATCAGGGTT GGG Intergenic
No off target data available for this crispr