ID: 905869833

View in Genome Browser
Species Human (GRCh38)
Location 1:41396826-41396848
Sequence ATCCTGGGACATCAGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905869826_905869833 -9 Left 905869826 1:41396812-41396834 CCCTGGGCCATGGGATCCTGGGA No data
Right 905869833 1:41396826-41396848 ATCCTGGGACATCAGGGTTGGGG No data
905869827_905869833 -10 Left 905869827 1:41396813-41396835 CCTGGGCCATGGGATCCTGGGAC No data
Right 905869833 1:41396826-41396848 ATCCTGGGACATCAGGGTTGGGG No data
905869820_905869833 6 Left 905869820 1:41396797-41396819 CCACCTGCACGGAGGCCCTGGGC No data
Right 905869833 1:41396826-41396848 ATCCTGGGACATCAGGGTTGGGG No data
905869821_905869833 3 Left 905869821 1:41396800-41396822 CCTGCACGGAGGCCCTGGGCCAT No data
Right 905869833 1:41396826-41396848 ATCCTGGGACATCAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905869833 Original CRISPR ATCCTGGGACATCAGGGTTG GGG Intergenic
No off target data available for this crispr