ID: 905871221

View in Genome Browser
Species Human (GRCh38)
Location 1:41405644-41405666
Sequence GAGAGTGACAAGTGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905871216_905871221 -10 Left 905871216 1:41405631-41405653 CCTTAAGGTAGGCGAGAGTGACA No data
Right 905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG No data
905871213_905871221 13 Left 905871213 1:41405608-41405630 CCATGGCACACACTTCTATGCTA No data
Right 905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG No data
905871210_905871221 30 Left 905871210 1:41405591-41405613 CCTCAAGCTGGTGTGGCCCATGG No data
Right 905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG No data
905871212_905871221 14 Left 905871212 1:41405607-41405629 CCCATGGCACACACTTCTATGCT No data
Right 905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905871221 Original CRISPR GAGAGTGACAAGTGTGGGGA GGG Intergenic
No off target data available for this crispr