ID: 905871595

View in Genome Browser
Species Human (GRCh38)
Location 1:41407535-41407557
Sequence CAGGGTGAACATGAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905871595_905871599 -7 Left 905871595 1:41407535-41407557 CCATCCTTCTCATGTTCACCCTG No data
Right 905871599 1:41407551-41407573 CACCCTGCATGGAGCCCCCAGGG No data
905871595_905871598 -8 Left 905871595 1:41407535-41407557 CCATCCTTCTCATGTTCACCCTG No data
Right 905871598 1:41407550-41407572 TCACCCTGCATGGAGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905871595 Original CRISPR CAGGGTGAACATGAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr