ID: 905873791

View in Genome Browser
Species Human (GRCh38)
Location 1:41419410-41419432
Sequence TGGCACAGGCTGAGCCGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905873788_905873791 -6 Left 905873788 1:41419393-41419415 CCTCATTGGGATGCTGGTGGCAC No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873778_905873791 19 Left 905873778 1:41419368-41419390 CCACCCCAAACTCCTGCCTGCAG No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873779_905873791 16 Left 905873779 1:41419371-41419393 CCCCAAACTCCTGCCTGCAGAAC No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873781_905873791 14 Left 905873781 1:41419373-41419395 CCAAACTCCTGCCTGCAGAACCT No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873780_905873791 15 Left 905873780 1:41419372-41419394 CCCAAACTCCTGCCTGCAGAACC No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873785_905873791 3 Left 905873785 1:41419384-41419406 CCTGCAGAACCTCATTGGGATGC No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data
905873783_905873791 7 Left 905873783 1:41419380-41419402 CCTGCCTGCAGAACCTCATTGGG No data
Right 905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905873791 Original CRISPR TGGCACAGGCTGAGCCGGCA AGG Intergenic
No off target data available for this crispr