ID: 905877194

View in Genome Browser
Species Human (GRCh38)
Location 1:41439815-41439837
Sequence CACAAGGTCTTGCTTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905877194_905877201 21 Left 905877194 1:41439815-41439837 CCAGCTGGAAGCAAGACCTTGTG No data
Right 905877201 1:41439859-41439881 TATCCCTGAAGGACAGAGTAGGG No data
905877194_905877198 10 Left 905877194 1:41439815-41439837 CCAGCTGGAAGCAAGACCTTGTG No data
Right 905877198 1:41439848-41439870 CCCATTTAGAGTATCCCTGAAGG No data
905877194_905877200 20 Left 905877194 1:41439815-41439837 CCAGCTGGAAGCAAGACCTTGTG No data
Right 905877200 1:41439858-41439880 GTATCCCTGAAGGACAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905877194 Original CRISPR CACAAGGTCTTGCTTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr