ID: 905877979

View in Genome Browser
Species Human (GRCh38)
Location 1:41445565-41445587
Sequence TGGTGCCATCTAGAGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905877979_905877988 5 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877988 1:41445593-41445615 TCTGCCTGAGCATCTGGGAGAGG No data
905877979_905877985 -1 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877985 1:41445587-41445609 ACCAGGTCTGCCTGAGCATCTGG No data
905877979_905877989 6 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877989 1:41445594-41445616 CTGCCTGAGCATCTGGGAGAGGG No data
905877979_905877991 17 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877991 1:41445605-41445627 TCTGGGAGAGGGAAAGTCTGTGG No data
905877979_905877992 18 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877992 1:41445606-41445628 CTGGGAGAGGGAAAGTCTGTGGG No data
905877979_905877987 0 Left 905877979 1:41445565-41445587 CCTGACCCCTCTAGATGGCACCA No data
Right 905877987 1:41445588-41445610 CCAGGTCTGCCTGAGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905877979 Original CRISPR TGGTGCCATCTAGAGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr