ID: 905878236

View in Genome Browser
Species Human (GRCh38)
Location 1:41447188-41447210
Sequence TTCTGGGGAAGGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905878236_905878250 16 Left 905878236 1:41447188-41447210 CCTTCTGCTCTCCTTCCCCAGAA No data
Right 905878250 1:41447227-41447249 CCTAGAGCTCAAATCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905878236 Original CRISPR TTCTGGGGAAGGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr