ID: 905879352

View in Genome Browser
Species Human (GRCh38)
Location 1:41453597-41453619
Sequence TGGATAGACCATGCGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905879352_905879357 17 Left 905879352 1:41453597-41453619 CCCAAGGACGCATGGTCTATCCA No data
Right 905879357 1:41453637-41453659 TGCCTACTAAGTATTTAGGGTGG No data
905879352_905879358 18 Left 905879352 1:41453597-41453619 CCCAAGGACGCATGGTCTATCCA No data
Right 905879358 1:41453638-41453660 GCCTACTAAGTATTTAGGGTGGG No data
905879352_905879355 13 Left 905879352 1:41453597-41453619 CCCAAGGACGCATGGTCTATCCA No data
Right 905879355 1:41453633-41453655 TGTGTGCCTACTAAGTATTTAGG No data
905879352_905879356 14 Left 905879352 1:41453597-41453619 CCCAAGGACGCATGGTCTATCCA No data
Right 905879356 1:41453634-41453656 GTGTGCCTACTAAGTATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905879352 Original CRISPR TGGATAGACCATGCGTCCTT GGG (reversed) Intergenic
No off target data available for this crispr