ID: 905880060

View in Genome Browser
Species Human (GRCh38)
Location 1:41457480-41457502
Sequence AGCAGCAGGGGCAGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905880050_905880060 -2 Left 905880050 1:41457459-41457481 CCCATCCCTGCTCCCAGGAAAAG No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880044_905880060 26 Left 905880044 1:41457431-41457453 CCCTGCTTTTCAGGCCTGGCCTT No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880048_905880060 3 Left 905880048 1:41457454-41457476 CCAGACCCATCCCTGCTCCCAGG No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880053_905880060 -8 Left 905880053 1:41457465-41457487 CCTGCTCCCAGGAAAAGCAGCAG No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880045_905880060 25 Left 905880045 1:41457432-41457454 CCTGCTTTTCAGGCCTGGCCTTC No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880046_905880060 12 Left 905880046 1:41457445-41457467 CCTGGCCTTCCAGACCCATCCCT No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880052_905880060 -7 Left 905880052 1:41457464-41457486 CCCTGCTCCCAGGAAAAGCAGCA No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880051_905880060 -3 Left 905880051 1:41457460-41457482 CCATCCCTGCTCCCAGGAAAAGC No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data
905880047_905880060 7 Left 905880047 1:41457450-41457472 CCTTCCAGACCCATCCCTGCTCC No data
Right 905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905880060 Original CRISPR AGCAGCAGGGGCAGCCCCGA GGG Intergenic