ID: 905883850

View in Genome Browser
Species Human (GRCh38)
Location 1:41481283-41481305
Sequence TCCCGCAGGCAGGTGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905883850_905883858 7 Left 905883850 1:41481283-41481305 CCCATCCCCACCTGCCTGCGGGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 905883858 1:41481313-41481335 CATTTCCACCCCTGTGCACCTGG 0: 1
1: 0
2: 3
3: 12
4: 208
905883850_905883865 28 Left 905883850 1:41481283-41481305 CCCATCCCCACCTGCCTGCGGGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 905883865 1:41481334-41481356 GGCATCTTTCCCTTTCCAGGTGG 0: 1
1: 0
2: 2
3: 20
4: 252
905883850_905883864 25 Left 905883850 1:41481283-41481305 CCCATCCCCACCTGCCTGCGGGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 905883864 1:41481331-41481353 CCTGGCATCTTTCCCTTTCCAGG 0: 1
1: 0
2: 1
3: 44
4: 353
905883850_905883866 29 Left 905883850 1:41481283-41481305 CCCATCCCCACCTGCCTGCGGGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 905883866 1:41481335-41481357 GCATCTTTCCCTTTCCAGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 189
905883850_905883867 30 Left 905883850 1:41481283-41481305 CCCATCCCCACCTGCCTGCGGGA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 905883867 1:41481336-41481358 CATCTTTCCCTTTCCAGGTGGGG 0: 1
1: 0
2: 1
3: 31
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905883850 Original CRISPR TCCCGCAGGCAGGTGGGGAT GGG (reversed) Intronic
900104410 1:976206-976228 TTCCGCCGGCAGGTGGGGCAAGG - Exonic
900538457 1:3190725-3190747 TCCTCCAGGCAGGTGGGCTTCGG - Intronic
900602681 1:3509761-3509783 GACCCCAGGCAGGTGGGGGTGGG + Intronic
901750312 1:11402871-11402893 TCCCTCAGGCAGGCGGGCCTGGG - Intergenic
901793540 1:11667279-11667301 TGCCCCAGGTAGGTGGGGGTTGG - Intronic
901911794 1:12464697-12464719 TCAGGAAGGCAGGTGGGGGTGGG + Intronic
902067914 1:13704273-13704295 TGCCTCAGGAAGGTGGGGGTGGG - Intronic
903670713 1:25033929-25033951 GCCCGTAGGCAGGAGGGGTTCGG + Intergenic
903994932 1:27299835-27299857 ACTGGCAGGCATGTGGGGATGGG - Intronic
904005600 1:27361626-27361648 ACCTGCAGGCAGTTGGGGAGTGG + Exonic
904614854 1:31744154-31744176 CCCTGCAGGCAGGTGGGGTGGGG + Intronic
904857289 1:33509282-33509304 TCCCGGAGGGAGGTGGGGGGGGG - Intergenic
905213540 1:36390945-36390967 TCCCACAGGCTGGTGGGCACTGG + Intergenic
905271194 1:36788838-36788860 ACCTGCAGGCAAGTGGGGCTGGG + Intergenic
905442866 1:38005753-38005775 TCCCTCTGGCAGCTGGGGATGGG - Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906672235 1:47664749-47664771 TAACACAGGAAGGTGGGGATAGG + Intergenic
911155161 1:94629378-94629400 TCCCTCTGTCAGGTGGGGAGAGG + Intergenic
916027519 1:160846624-160846646 TCACCCAGGCAGGAGGGGAGTGG - Intronic
916172725 1:162012789-162012811 TCCTGCAGCAAGGTGGGGGTGGG + Intronic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
919705870 1:200675071-200675093 TCCAGCAGGCAGGTGGAGGAGGG + Intergenic
920052049 1:203170280-203170302 TCCAGAAGGCAGGTGGGTTTGGG - Exonic
922335861 1:224617560-224617582 TCCCGCCGGCAGGAGAGGACGGG - Intronic
924763283 1:247008273-247008295 TCCCCCAGGCAGGTGGGTCCAGG - Intergenic
1062960254 10:1567911-1567933 TCCCGCAGGCAGGAGGCAAAGGG - Intronic
1063901062 10:10732889-10732911 TTCAGCAGGCAGGCTGGGATTGG + Intergenic
1067001862 10:42622678-42622700 TACCACAGGCTGGTGGGAATGGG + Intronic
1069018940 10:63465137-63465159 CCGCGCGGGCAGGTGGGGGTAGG - Intronic
1069900920 10:71706204-71706226 TTCCTCAGGCAGATGGGGCTTGG - Intronic
1070750612 10:78961963-78961985 TCCAGCAGGCAAGTGGAGAAGGG + Intergenic
1070797237 10:79223826-79223848 TCCCTCAGGGAGGTGGGGGAGGG - Intronic
1071864848 10:89717012-89717034 TCCCGTAGTCAGTTGGGCATGGG + Intronic
1073429921 10:103479286-103479308 TCCCCCAGACAGGAGGGGAGTGG - Intergenic
1073611304 10:104946697-104946719 ACCCACAGGGAGGTGGGGAGAGG - Intronic
1075137004 10:119794853-119794875 TCCGGGAGGGAGGTGGGGAGGGG - Intronic
1075675545 10:124293462-124293484 TCCCGCAGGCCACTGGGGCTTGG + Intergenic
1076143107 10:128095500-128095522 TCCCCCTGGGAGGTGGGGTTGGG + Intergenic
1076258067 10:129044649-129044671 TCCCAGAAGCAGGTGGGGACCGG + Intergenic
1077248274 11:1549479-1549501 CCCTGCAGGCAGCTGGGGCTCGG - Intergenic
1078862255 11:15260103-15260125 TCCCTCAGGCAGGCTGGGTTGGG - Intergenic
1078902154 11:15651297-15651319 TCCCGGAGGCAGACGGGGAGCGG + Intergenic
1081784796 11:45738615-45738637 TCCGGCAGGGAGGTGGGGGGGGG - Intergenic
1083831520 11:65236677-65236699 TCCCACAGGCAGATGGGGATGGG + Intergenic
1084179375 11:67438834-67438856 TCCCGCAGTGAGATGAGGATCGG + Exonic
1088648464 11:111937203-111937225 TCCCGCAGGAAAGCGGGGCTGGG + Intronic
1089560871 11:119342495-119342517 CCCCTCAGGGAGGTTGGGATGGG + Intronic
1089928029 11:122279631-122279653 CCCCTCAGGCAGGTGGGGATAGG - Intergenic
1090322936 11:125863102-125863124 TCCGGGAGGGAGGTGGGGAGGGG + Intergenic
1091151350 11:133331213-133331235 GCCAGCAGGCAAGTGGGGTTTGG - Intronic
1094704017 12:32897029-32897051 GCCCGCGGGGAGGTGGGGAGAGG + Intergenic
1096773361 12:53950204-53950226 ACCAGGAGGCAGGTGGGGGTGGG - Intergenic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1103707854 12:122888886-122888908 TCCCGCAGGCAGTTGGAGTGTGG - Intronic
1106796585 13:33212534-33212556 TCCTGCAGGCAGGTGTGGGCAGG + Intronic
1107140274 13:36991275-36991297 TCCCGGGGGAAGGTGGGGATGGG - Intronic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1113927471 13:113949799-113949821 TCCCCAAGGCAGGGGGCGATGGG - Intergenic
1115498628 14:34030062-34030084 TCCCACTGGGAGGTGGGGTTGGG + Intronic
1118324096 14:64769804-64769826 TCCCACAGGCAGGGGGAGGTGGG - Intronic
1119400306 14:74358326-74358348 GCCCGCAGGCAGGTGCTGAGTGG + Exonic
1119805188 14:77477817-77477839 TCCTCCAGGCAGCTGGGCATGGG - Intronic
1120393209 14:83934708-83934730 TGCCCCAGGCAGGAGAGGATGGG - Intergenic
1120829890 14:88988359-88988381 TTCAGCAGGCAGATGGGGAAAGG + Intergenic
1121796669 14:96741658-96741680 TCCCGCGGGCGGGTGGTGCTTGG - Intergenic
1122410469 14:101523112-101523134 GCCCACAGGAATGTGGGGATGGG + Intergenic
1122473462 14:101988328-101988350 CCCCGTAGACAAGTGGGGATGGG + Intronic
1122856139 14:104561086-104561108 CTCCCCAGCCAGGTGGGGATGGG + Intronic
1122880290 14:104687804-104687826 TCCCCCAGGCAGGTGGACAGGGG + Intergenic
1123115414 14:105892184-105892206 TCCCAGAGCCAGGAGGGGATGGG + Intergenic
1123412743 15:20073407-20073429 TCCAGCGGGCAGGCGGGGCTTGG - Intergenic
1123522085 15:21080520-21080542 TCCAGCGGGCAGGCGGGGCTTGG - Intergenic
1126168265 15:45672198-45672220 ACCCCCAGGCAGGTGGGCAGAGG + Intronic
1126413227 15:48393586-48393608 TTCCACAGGCTGGTGGGGTTGGG + Intergenic
1128506742 15:68278083-68278105 TCCCGCAGGAAGGAGGGGTCCGG + Exonic
1129180033 15:73868211-73868233 AACCGCAGGCAAGTGGGGGTGGG + Intergenic
1129803948 15:78438543-78438565 TCGCGCAGGAGGGTGGGGATCGG - Intronic
1131524608 15:93143082-93143104 TCCTGGAGGCAGCAGGGGATGGG - Intergenic
1132270398 15:100519306-100519328 TGCTGCTGGAAGGTGGGGATGGG - Intronic
1133266384 16:4586905-4586927 GACAGCAGGCAGGTGGGCATGGG - Intronic
1133281255 16:4666695-4666717 TGCCGCAGGCAGGTGGCGGAAGG - Intronic
1133360910 16:5173195-5173217 TGCACCAGGCAGGAGGGGATGGG + Intergenic
1133777503 16:8909052-8909074 TCCGGCAGTCAGCTGGGGAAGGG - Intronic
1134120486 16:11580726-11580748 TCCTGGAGGCAGGTGGTGATAGG - Intronic
1134515172 16:14881370-14881392 TCCGGCAGGAAGGTGTGGTTTGG + Intronic
1135975770 16:27108264-27108286 TCAGGCAGGCAGGTGGGGGACGG + Intergenic
1136172449 16:28497059-28497081 TCCCAGAGGCAGGCGGGGAGGGG + Exonic
1136403548 16:30030876-30030898 GCCACCAGGCAGGTGGGGAGGGG + Exonic
1137546901 16:49411008-49411030 CCCCACAGGCAGGTGGGGCTTGG - Intergenic
1137586397 16:49666321-49666343 TGTCGAAGGCAGGTGGGGAATGG - Intronic
1137623477 16:49892386-49892408 TCCCACAGGCAGTTGGTGACTGG - Intergenic
1138627773 16:58266155-58266177 TCCCCCAGGCAGGTGGTTCTAGG + Intronic
1139693580 16:68656954-68656976 TGCTGGAGGCAGGTGGGGGTGGG - Intronic
1141163629 16:81645698-81645720 TGCCGCTGGCTGGTGGGGCTTGG + Intronic
1141614360 16:85202233-85202255 TCCAGAAGGCAGTTGGGGCTGGG - Intergenic
1141847109 16:86618399-86618421 ACCTGCAGGCAGTTGGGGTTGGG - Intergenic
1141999207 16:87654587-87654609 TCCCGGTGGCAGCTGGGGAATGG + Intronic
1142110123 16:88326886-88326908 CCCCGCTGCCAGGTGGGCATTGG - Intergenic
1143105954 17:4530653-4530675 TCCCGGGGGCTGGTGGGCATCGG + Exonic
1143512315 17:7403663-7403685 TCCCGTAGGCATCTGGGAATTGG + Exonic
1143697735 17:8632314-8632336 CCCAGCAGGCAGGTGGGGGTGGG - Intergenic
1144670882 17:17131981-17132003 TCCTGCTGGCAGCTGGGGAGGGG + Intronic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1145981055 17:29011821-29011843 TGCCCCTGGCAGGTGGGCATCGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148685129 17:49496641-49496663 TCGCGCAGCTAGGTGGGGAGCGG - Intronic
1148993672 17:51688681-51688703 TTCTGCAGGCAGATGGGGAAAGG - Intronic
1150056458 17:62021371-62021393 TCCGGGAGGGAGGTGGGGAGGGG - Intronic
1151196085 17:72432068-72432090 TATGGGAGGCAGGTGGGGATGGG - Intergenic
1151366039 17:73617156-73617178 TCCCGCAGAGAGGAGGGGAGAGG + Intronic
1152091390 17:78249640-78249662 TCCCACAGACAGGTGGGGTGGGG - Intergenic
1152388187 17:79987608-79987630 TTCCGAATGAAGGTGGGGATGGG + Intronic
1152388924 17:79991684-79991706 AGCCACAGGCAGGTGGGGGTGGG + Intronic
1152583308 17:81178538-81178560 GCCTGCAGGCCGGTGGGGGTGGG - Intergenic
1152584575 17:81183300-81183322 GCCCACAGCCAGGTGGGGCTGGG - Intergenic
1152924306 17:83080287-83080309 TCCCGGGGGCAGGCGGGGGTCGG + Intronic
1156338069 18:36187355-36187377 TCCCGCGCCCAGGTGGGGAAAGG + Intergenic
1156462373 18:37328326-37328348 CCCCGCAGGGAGCTGGGGAGAGG + Intronic
1157587977 18:48817353-48817375 TCCCTGAGGCAGGTGTAGATGGG - Exonic
1159166581 18:64710086-64710108 TCCTGGAGGATGGTGGGGATGGG + Intergenic
1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG + Exonic
1165854524 19:38871476-38871498 TCCCAGAGGGAGGAGGGGATGGG - Intronic
1165913377 19:39243729-39243751 TCCTGTAGGGAGGAGGGGATGGG + Exonic
1165917578 19:39269894-39269916 TCCTGTAGGGAGGAGGGGATGGG - Exonic
1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG + Exonic
1167122773 19:47528839-47528861 TGCCACAGGCAGGTGAGGGTGGG + Intronic
1167213226 19:48146875-48146897 TCACACAGGGAGGTGGGGGTAGG - Intronic
1167646728 19:50710085-50710107 CCCCACAGGCAGATGGGGGTGGG - Intronic
1168489556 19:56796658-56796680 TCCCCCAGGCAGTGGGGGGTGGG + Intronic
1168523646 19:57071694-57071716 CCCAGGAGCCAGGTGGGGATGGG + Intergenic
925497078 2:4463819-4463841 TCCAGCAAGAAGGTGGGGAAGGG - Intergenic
926007241 2:9381862-9381884 TCCCCCAGGCTGGTGCGCATTGG - Intronic
926251865 2:11159396-11159418 GCCTGCAGGCAGCTGGGGGTGGG + Intronic
932411169 2:71548875-71548897 GCCCGCAGGCAGGTCGTGCTTGG - Intronic
935360916 2:102245657-102245679 TCCCGCTGGCCCGTGGGGAGGGG + Intergenic
937980561 2:127612210-127612232 TCCCGCAGGAAGGTGAGCCTGGG - Intronic
941003674 2:160226045-160226067 TCCCGCAGGCTGGTGAGGCCTGG - Intronic
943225534 2:185169485-185169507 TACAGCAGGGAGGTGGGGAGTGG - Intergenic
943257239 2:185611354-185611376 TGCCAAAGTCAGGTGGGGATGGG + Intergenic
946339015 2:219056705-219056727 GCCGGCAGCCAGGTGGGGCTTGG + Intronic
947732436 2:232438937-232438959 TCCCCGGGGCAGGAGGGGATGGG - Intergenic
948723918 2:239920205-239920227 TTCAGCAGGAAGGTGGGGAGAGG + Intronic
948756877 2:240165223-240165245 ACCTGCAGGCAGGTGTGGATGGG - Intergenic
948863054 2:240762197-240762219 GCCCACATGCAGGTGGGGAGGGG - Intronic
1169218620 20:3807642-3807664 GCCCCCAGGCGGGTGGGGCTGGG + Intergenic
1169560707 20:6797825-6797847 TCACTCTGCCAGGTGGGGATAGG + Intergenic
1170509655 20:17063664-17063686 GCCCTCAGGCAGGTGGAGACAGG + Intergenic
1171848394 20:30291657-30291679 TCCGGGAGGGAGGTGGGGGTCGG - Intergenic
1171848438 20:30291750-30291772 TCCGGGAGGGAGGTGGGGGTCGG - Intergenic
1172097964 20:32469825-32469847 TCCTCCAGGGAGGTGGGGACAGG + Intronic
1173249786 20:41358383-41358405 GCCTGCAGGCAGCTGGGGAGAGG - Intronic
1173686034 20:44924099-44924121 TCCCCAAGGCAGTTGGGGCTTGG + Intronic
1175338564 20:58212855-58212877 TCCTGCAGGAAGATGGGAATCGG + Intergenic
1176086193 20:63296621-63296643 TCCAGCAGGGAGCTGGGGAAGGG + Intronic
1176113358 20:63420734-63420756 TCTTGCAGGCTGGTGGGGCTTGG - Intronic
1176168261 20:63685688-63685710 TCCAGGAGGCAGGTGGGGCTGGG + Intronic
1181053661 22:20249303-20249325 TCAGGCAGGCAGATGGGCATGGG - Intronic
1181871447 22:25902563-25902585 CCCCGTAGGCAGGTGGGCAGGGG - Intronic
1181964368 22:26646262-26646284 TCCAGAAGGCAGGTAGGGACTGG - Intergenic
1182290969 22:29279273-29279295 TCACACAGGCAGGAGGGGAAGGG + Intronic
1183041412 22:35181550-35181572 TCCTGCAGGCAAGTGGGGTGAGG - Intergenic
1183285692 22:36961477-36961499 TCCCCCAGGCACATGGGGGTTGG - Intergenic
1183307093 22:37088379-37088401 GCCTCCAGGCAGATGGGGATGGG - Intronic
1184644522 22:45888926-45888948 ACCCTCAGGCAGGTGAGGCTTGG + Intergenic
1184837944 22:47035205-47035227 CCCCGGAGGCAGGCGGGGGTGGG - Intronic
950409684 3:12827428-12827450 TCCCTCCTGCAGGTGGAGATGGG + Exonic
951590886 3:24263177-24263199 TCCAGCAGGCAAGGTGGGATTGG - Intronic
953030744 3:39178143-39178165 TCCGGGACGCAGGTGGGGGTTGG + Intergenic
957040112 3:75329835-75329857 GCCAGGAGGAAGGTGGGGATGGG + Intergenic
961044899 3:123701378-123701400 GCCAGGAGGAAGGTGGGGATGGG + Intronic
961325790 3:126108521-126108543 TCCATGAGGCAGGTGGGGTTGGG - Intronic
961440736 3:126951698-126951720 TCCCTCATCCAGCTGGGGATGGG + Intronic
961555033 3:127691503-127691525 TCCCCCTGGCAGGAGGGGAAGGG + Exonic
966976196 3:185085595-185085617 TCCCCCAGGCAGGTGTGACTGGG - Intronic
968622516 4:1610304-1610326 TCCGGCAGGCAGCTGGGGTCCGG - Intergenic
968702687 4:2064348-2064370 CCGCCCAGGCAGGTGGGGAAGGG - Exonic
969248560 4:5952530-5952552 ACCCGCAGCCAGGTGGGGAGCGG - Intronic
970371570 4:15412323-15412345 TCCCACAGACTGGTGGGGGTGGG - Intronic
971243959 4:24912492-24912514 GCGGGCAGGCAGGTGGGGCTTGG + Intronic
976493645 4:85700354-85700376 TCCCCCAGGCAGGTGTGCAGTGG - Intronic
978777948 4:112521321-112521343 TCCCCAGAGCAGGTGGGGATAGG - Intergenic
980998152 4:139801453-139801475 ACCTGCAGGCAGGAGGGGAGGGG + Intronic
984765100 4:183394291-183394313 TCCCGCTGGCCTGTGGGGAGTGG - Intergenic
985629400 5:1006918-1006940 TGCCCCAGCCAGGTGGGGAAGGG - Intergenic
985744833 5:1640588-1640610 TCCTCCAGGAAGGTGGGGAGGGG - Intergenic
985861784 5:2477225-2477247 ACCCGGAGGCAGGAGGGGCTGGG - Intergenic
986717340 5:10533729-10533751 CCCAGGAGGCAGGTGGGGAGGGG - Intergenic
988503044 5:31799313-31799335 GCCTGCAGGAAGGTGGGGATGGG + Exonic
992452315 5:76885593-76885615 TCCCCCAGGAAAGTGGGAATGGG + Intronic
994887400 5:105582405-105582427 TGGTGCAGGCAGGTGGGGAGGGG + Intergenic
997564603 5:134877227-134877249 GCTCTAAGGCAGGTGGGGATAGG + Intronic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
998349618 5:141492172-141492194 TCCCGCAGACAGGTGCGGTTGGG - Intronic
999719915 5:154391986-154392008 GACTGCAGGAAGGTGGGGATGGG + Intronic
1000070244 5:157733930-157733952 TCCCTCAGGCTGGGGTGGATTGG - Intronic
1001294569 5:170489882-170489904 GCCTGCAGGCATGTGGGGCTTGG - Intronic
1001837367 5:174843637-174843659 TCCCGCTGGGAGCTGGGGAGGGG + Intergenic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1002042958 5:176527904-176527926 TCGCCCAGGCAGGTGGGAGTTGG + Exonic
1003876984 6:10446712-10446734 TCCCCCAGGCTGGTGTGCATTGG + Intergenic
1006119044 6:31792871-31792893 TCCGGCGGGCAGGTGGGTCTAGG + Exonic
1006457899 6:34142543-34142565 CCCCGCAGCAGGGTGGGGATGGG + Intronic
1006621943 6:35371454-35371476 TCCAGCAGGCAGGTGGACACAGG - Intronic
1007758081 6:44113895-44113917 TTGCGCAGGCTGGTGGGGATGGG + Exonic
1011165302 6:84439788-84439810 TCCCAGAGACTGGTGGGGATGGG - Intergenic
1012446310 6:99310487-99310509 TCACCCAGGGAGGTGGGGAGCGG - Intronic
1014774557 6:125493832-125493854 TCCCTCAAACAGGTGGTGATGGG + Intergenic
1015544257 6:134345951-134345973 TCCCAAAGGCAAGTGGGAATGGG + Intergenic
1016923572 6:149318213-149318235 TCCCCCAGTCCGGTGGGGGTGGG + Intronic
1017796327 6:157848007-157848029 TACAGCAGGCAGGTGAGGAGGGG - Intronic
1019536695 7:1533176-1533198 TCCCACAGGCCGGTGGGGTCTGG + Intronic
1019540318 7:1548297-1548319 TCCCGCCAGCAGGTGGAGAGAGG - Intronic
1023868124 7:44248511-44248533 GACCCCAGGCAGGTGGGCATCGG - Intronic
1025294782 7:57768823-57768845 TGCCACAGGCATGAGGGGATGGG - Intergenic
1025745279 7:64237372-64237394 TCTAGCAGCCAGGTGGGGAGAGG + Intronic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1030488906 7:110206584-110206606 GCTAGCAGGCAGGTGGGGAATGG - Intergenic
1032300490 7:130681977-130681999 TCCCCCAGGCTGGAGGGCATTGG + Intronic
1032613597 7:133442542-133442564 TGCCTCAGGCTAGTGGGGATGGG + Intronic
1032753867 7:134869699-134869721 TCCTGCAGGCATGTGGAGATAGG + Intronic
1034556102 7:151851411-151851433 GCCCACAGCGAGGTGGGGATCGG - Intronic
1035186940 7:157133830-157133852 TCCCCCAGGCTGGTGTGGAGTGG + Intergenic
1035564384 8:631415-631437 TCATGCAGGCGGGTGAGGATGGG + Intronic
1036709128 8:11067133-11067155 TCACCCAGGCTGGTGGGGAGGGG + Intronic
1039843020 8:41307115-41307137 TCCCGCAGGCTGCAGGGGATGGG + Intronic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1052982408 9:34458643-34458665 TCCCGCATGTGGGTGGGGCTGGG - Intronic
1053168359 9:35860527-35860549 TCCGGAAGGCAGGTGGGTAATGG + Intergenic
1055920264 9:81452691-81452713 TCCCCTAGGCAGGGTGGGATAGG + Intergenic
1057054072 9:91948702-91948724 TCCTGCAGGAAGGTGAGAATCGG - Intronic
1058856525 9:109068005-109068027 TTCAGCAGATAGGTGGGGATGGG - Intronic
1060665541 9:125430167-125430189 TGCAGCAGGCAGCTGGGGAGTGG - Intergenic
1061296145 9:129677745-129677767 TCCCGCAGGGATGTGGTGGTGGG - Intronic
1061800360 9:133110227-133110249 ACCCGCAGCCAGGTGGGGGTGGG + Intronic
1061913792 9:133738618-133738640 TCCAGCAGGCAGGTGGTGCCTGG - Intronic
1061927615 9:133813641-133813663 TCCCGCAGGCAGGCGGGCAAAGG + Intronic
1062029081 9:134353914-134353936 TCCCCAAGGCTGGTGGTGATGGG + Intronic
1185461781 X:336126-336148 TCACGCAGGCTGGAGGGCATTGG - Intronic
1187950315 X:24464817-24464839 TCAGGCAGGGAGGTGGGGGTGGG + Intergenic
1189287318 X:39860930-39860952 TCCCACAGCCAGGAGGGGACAGG + Intergenic
1189346703 X:40247430-40247452 TCCCTCTAGCAGGTGGGGGTGGG - Intergenic
1189709440 X:43794396-43794418 TCAAGCAGGAAGGTGGGGAGAGG - Intronic
1190047431 X:47124011-47124033 TGCCCCAGGCAGGTGGGAATGGG - Intergenic
1190638040 X:52455674-52455696 TCCTGCAGGCAGGTAGAGACTGG + Intergenic
1190640041 X:52475465-52475487 TCCTGCAGGCAGGTAGAGACAGG + Intergenic
1190647631 X:52537400-52537422 TCCTGCAGGCAGGTAGAGACAGG - Intergenic
1190678618 X:52804776-52804798 TCCTGCAGGCAGGTAGAGACAGG - Intergenic
1191184007 X:57591466-57591488 TCCCGCGGGGAGGTGGGAAGGGG + Intergenic
1191834994 X:65454638-65454660 TCCAGCACGCAGCTGGAGATCGG + Intronic
1194405552 X:93492328-93492350 TCACTCAGGCAGGTGGTGATGGG - Intergenic
1199860277 X:151795190-151795212 TCCAACAGGCATGTGGAGATGGG - Intergenic