ID: 905884417

View in Genome Browser
Species Human (GRCh38)
Location 1:41484198-41484220
Sequence CCTTCCCTGCATGCACAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905884405_905884417 29 Left 905884405 1:41484146-41484168 CCTTGGGCATGAGATGAGGACGC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 905884417 1:41484198-41484220 CCTTCCCTGCATGCACAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 245
905884411_905884417 -2 Left 905884411 1:41484177-41484199 CCAGGGTGGCAGCAGCCTGGCCC 0: 1
1: 0
2: 7
3: 60
4: 536
Right 905884417 1:41484198-41484220 CCTTCCCTGCATGCACAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905884417 Original CRISPR CCTTCCCTGCATGCACAGGA GGG Exonic
902931526 1:19734873-19734895 CCCTCACTGCAGCCACAGGAGGG - Intronic
903233402 1:21935373-21935395 CCTTCCCAGCACTCACAGGCTGG - Intronic
904928481 1:34067022-34067044 CCTTCCCTGCAGGCTGAGGGAGG - Intronic
905205146 1:36339192-36339214 CCTTCCCTGGCTGCCCTGGATGG + Intergenic
905549152 1:38822341-38822363 CCTTCCCTGCCTGCAGAGCGTGG - Intergenic
905738712 1:40350640-40350662 ACTTCCCTGGATTCACAGGTTGG - Intronic
905856765 1:41319673-41319695 CCTTCCCCTCACCCACAGGAGGG - Intergenic
905884417 1:41484198-41484220 CCTTCCCTGCATGCACAGGAGGG + Exonic
907511665 1:54965943-54965965 CCTTCCCAGCATGCAAAGGCTGG - Intergenic
908381625 1:63602378-63602400 CCTTCCCTGCATGCCCTTAATGG - Intronic
912495101 1:110086430-110086452 CCACAGCTGCATGCACAGGATGG - Intergenic
913219866 1:116650700-116650722 CCTTATCTGCCAGCACAGGATGG - Intronic
914923610 1:151864786-151864808 CGTTGCCTGCCTGCACAGGTTGG - Intergenic
915357020 1:155261558-155261580 ACTTTTCTGCATGCACAGGAAGG - Intronic
920416973 1:205805464-205805486 CCTAGCCTGGATGAACAGGATGG - Intronic
920967669 1:210714699-210714721 CCATCCCTGCCTTCAAAGGAAGG + Intronic
921469291 1:215529427-215529449 CCTTACCTGCGTGCACAGTTGGG - Intergenic
922787428 1:228289900-228289922 CCTTCCCTGCATTCCCTGTAAGG - Intronic
923929172 1:238674071-238674093 CCTTCCCTGCATGCATACCCTGG - Intergenic
924745592 1:246830890-246830912 CTTTCCCTGCCAGCTCAGGAAGG + Intergenic
1063085675 10:2815702-2815724 CCTCCCCAGCTTTCACAGGAGGG - Intergenic
1066575065 10:36816680-36816702 ACTTCCCATGATGCACAGGATGG + Intergenic
1067287179 10:44915007-44915029 CCTTCCCTCCATGCCCAGCCTGG - Intronic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1069131435 10:64709103-64709125 TCTGCCCTGCATGCACATGCTGG + Intergenic
1070109919 10:73475585-73475607 CCTTCCCTTCATGGGCAGCATGG - Intronic
1070750935 10:78963660-78963682 CCCTGCATGTATGCACAGGAAGG - Intergenic
1071039126 10:81285649-81285671 CCTTTCATGCATGCATAGGTTGG - Intergenic
1072430634 10:95367942-95367964 CCTTGGCTGCATCCACTGGAAGG - Intronic
1072856328 10:98951424-98951446 CTTTTCTTGCATGCAAAGGAGGG - Intronic
1073245322 10:102086324-102086346 CCTACCCTGCACACCCAGGAAGG + Intergenic
1073483381 10:103801018-103801040 CCTACCCTGCAGGCAAGGGAGGG + Intronic
1075069156 10:119309171-119309193 CCTTCCCTGATTCCACAGGCAGG + Intronic
1076060625 10:127411457-127411479 ACATCCCTGGATGCACTGGATGG - Intronic
1076259734 10:129055821-129055843 GCTTCCCTGGATGTTCAGGAAGG - Intergenic
1077096035 11:799560-799582 TCATCCCTGCAGGCAGAGGATGG + Exonic
1077227020 11:1442961-1442983 CATTCCCTGCATCCCCAGGCGGG - Intronic
1077289795 11:1783717-1783739 CCTGCCCTCCAGGCAGAGGAGGG + Intergenic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1078039653 11:7848088-7848110 CCTTCAATGAATGCACAGGCTGG - Intergenic
1079078401 11:17397453-17397475 CCCTCCCTGGAGGCACAGGGAGG + Intronic
1081776445 11:45678911-45678933 CCTTCCCATCATGCATGGGAGGG - Intergenic
1083514405 11:63243237-63243259 CCAGCCGTACATGCACAGGATGG + Intronic
1083621196 11:64050202-64050224 CCCTCCCTGCATCCCCAGGCTGG - Intronic
1083624608 11:64065829-64065851 CCCTCTCTCCATGCACAGGCAGG + Intronic
1084501921 11:69540147-69540169 CTTTCCCTGCCTTCCCAGGAGGG - Intergenic
1084942645 11:72621224-72621246 CCTTCTCTGAATACCCAGGAAGG - Intronic
1085051175 11:73381044-73381066 CATTCCCTCCAAGCACAGGCAGG + Intronic
1085202073 11:74707843-74707865 CCACCCATGCATGCACAGCAGGG + Intronic
1085725050 11:78947829-78947851 AGTTCCCTCCATGCCCAGGAAGG + Intronic
1087708820 11:101525932-101525954 CCTTCCCTGATTCCATAGGATGG + Intronic
1088717728 11:112563574-112563596 CCTTCCCTAGATGCCCAGGCTGG + Intergenic
1090234077 11:125133515-125133537 CCTTCCCTGGCTGGGCAGGATGG + Intergenic
1090934038 11:131325854-131325876 CCTTCCCTCCAGGTAGAGGAAGG - Intergenic
1092281611 12:7101867-7101889 CCCTCCCTGCACCCCCAGGAGGG + Intronic
1094125826 12:27021634-27021656 CCTTCCCCGCAGCCACAGGAAGG + Intergenic
1095190972 12:39257505-39257527 CCTGCCCTGCAAGCATGGGAAGG - Intergenic
1095874339 12:47064006-47064028 CCTTCCCTCCAGGTATAGGAAGG + Intergenic
1096918378 12:55057712-55057734 CCTTCCCTGCCTGCCCTGGAGGG + Intergenic
1104050650 12:125191309-125191331 CTTTCCCTGCATGAACTTGATGG + Intronic
1104427906 12:128693168-128693190 TCTCCCCTGCATGCACATGCAGG - Intronic
1104845566 12:131845106-131845128 CTCTCCCTGCAGGCCCAGGAAGG + Exonic
1105704378 13:22960338-22960360 CCTTCCCTGCCTGCAAAGTCAGG - Intergenic
1105857329 13:24385390-24385412 CCTTCCCTGCCTGCAAAGTCAGG - Intergenic
1106919336 13:34547006-34547028 CATTCCCTGCATGCACTTGCTGG - Intergenic
1109535973 13:63720184-63720206 CCTTCTTTGCATGCACAAAAAGG - Intergenic
1109540127 13:63766102-63766124 CCTTCTTTGCATGCACAAAAAGG + Intergenic
1112817389 13:103288830-103288852 ACTTCACTGCATGCTCAGGGTGG - Intergenic
1113579194 13:111416955-111416977 AGTTCCCTGCAGGCTCAGGAAGG + Intergenic
1114082262 14:19211217-19211239 CATTCCCAGGATGCACAGGGTGG - Intergenic
1116291627 14:43050534-43050556 TCTTCCCTTCAGGCACAGAAAGG + Intergenic
1117868419 14:60172984-60173006 CCTGCGCTGCAGGGACAGGAAGG - Intergenic
1120357614 14:83454584-83454606 TGTTCCCTGAATGCTCAGGAAGG + Intergenic
1121277265 14:92676876-92676898 CCTTCCCTGACTGCACAGTCTGG - Intronic
1122865581 14:104602562-104602584 CCTGCCCTGCATGCACAGCATGG + Intronic
1122892369 14:104738736-104738758 CCTTCCCTGCAGGCATAGTTAGG - Intronic
1124233955 15:27970764-27970786 ACATCCCAGCATGCACAGTATGG + Intronic
1124233982 15:27970921-27970943 ACGTCCCAGCATGCACAGTACGG + Intronic
1124694010 15:31848270-31848292 CCCTCCCTGCGTGCCCAGCAGGG - Intronic
1126397657 15:48235957-48235979 CCTTACCTGGTTGCAAAGGAGGG + Intronic
1128072049 15:64803808-64803830 CCTTCCCCAAAGGCACAGGAAGG - Intergenic
1128983413 15:72202308-72202330 CCTTCCCTGCAGGCCCAAGGTGG + Intronic
1129756816 15:78103740-78103762 CCTCCCATCCATGCACAGGAGGG + Exonic
1130953059 15:88606979-88607001 CTTTTCCTGGATGTACAGGAGGG + Intergenic
1130986031 15:88845389-88845411 CCTTCCCTGCTGGGGCAGGAGGG - Intronic
1131671834 15:94627954-94627976 TCTTCTGTGCATGCCCAGGACGG + Intergenic
1132513539 16:355201-355223 CCTGCCCTGCAGGGACAGGAAGG + Intergenic
1133278566 16:4652338-4652360 ACTTCCTGCCATGCACAGGACGG + Intronic
1134483970 16:14642131-14642153 CCTTCCCTGCATGGCCAGTGTGG + Intronic
1134895984 16:17887079-17887101 CCTGCCCCGCATGCAGAGGAAGG + Intergenic
1135453734 16:22579753-22579775 GCTTTCCTGCATGCAAAGGACGG - Intergenic
1136014021 16:27383477-27383499 CCATCCCACCATGCACAGGATGG + Intergenic
1136750158 16:32628362-32628384 CCTGCCATTCATGAACAGGAAGG + Intergenic
1137436216 16:48455928-48455950 CCTTCCCTGCAGGCACATGTGGG + Intergenic
1137892639 16:52178694-52178716 CCATCCCTGTGAGCACAGGAGGG - Intergenic
1138157856 16:54722494-54722516 CCTCCTCTGCAGCCACAGGAGGG - Intergenic
1138534314 16:57651888-57651910 CCTTCTCTGCAGCCTCAGGACGG - Intronic
1139476309 16:67204212-67204234 CCCTCCCTGCAGGCCCAGCATGG - Intergenic
1141836502 16:86543665-86543687 CCTTTTCTGCATTCACAGAAGGG - Intronic
1141851332 16:86648123-86648145 CCTTCCCTGAATGCACATAGTGG - Intergenic
1203052288 16_KI270728v1_random:887561-887583 CCTGCCATTCATGAACAGGAAGG + Intergenic
1142970321 17:3606884-3606906 CCTGCCCAGCATGCAGTGGATGG - Intergenic
1142997407 17:3769080-3769102 CCTTCCCTGCTCCCCCAGGAAGG + Intronic
1143400524 17:6639725-6639747 CCTCTCCTGCAGGCACGGGATGG + Intronic
1143773570 17:9183291-9183313 CCTTCTCTGCAGCCCCAGGAAGG - Intronic
1145102358 17:20087736-20087758 CCTTCCCTAGTAGCACAGGAAGG + Intronic
1146506205 17:33407967-33407989 CCTCCCCACCATGAACAGGAAGG - Intronic
1147586226 17:41655277-41655299 CCCTCCCTGCCTGCAAAGAAAGG + Intergenic
1147642119 17:42009377-42009399 CCGTCCCTGCCTGAACAGTAGGG - Intronic
1148804571 17:50257718-50257740 CCCTCCCTCCATGCACTGCAGGG + Intergenic
1150208477 17:63427769-63427791 CCATCACTGCATCCTCAGGAGGG - Intergenic
1151014421 17:70537491-70537513 CCTTCCTTTCATGAACAGGCAGG + Intergenic
1152266095 17:79295790-79295812 CCTTCCCTGGCTGCAAAGCATGG + Intronic
1152636639 17:81432908-81432930 CCTTCCCCCCATCCCCAGGAAGG + Intronic
1154388398 18:13916184-13916206 CCTTCCCTGCAGGCCCCGGCAGG - Intergenic
1155500759 18:26484766-26484788 CCTTCCCTGCCTGCCTAGGCCGG - Intronic
1158892708 18:61887998-61888020 CCTGCCTTTCATGCAAAGGAGGG - Intronic
1159493620 18:69171305-69171327 CCTTCACTGCAGTCACAGAATGG - Intergenic
1160875341 19:1294118-1294140 TCCTCCCTCCATGCACAGGCAGG - Intronic
1161048534 19:2150260-2150282 GCTTCCCTGCGTGGACAGCAAGG - Intronic
1162761530 19:12891470-12891492 CTTTCTCTGCAAGCACAGAACGG - Exonic
1162795498 19:13085375-13085397 CCTTCCAAGCAACCACAGGACGG - Intronic
1163133254 19:15289855-15289877 CCCTGCCTGCATAGACAGGAAGG + Intronic
1163677447 19:18662480-18662502 GCATCCCTGCATGCACGGGCAGG + Intronic
1163845737 19:19637360-19637382 CCTTCCCTCCTTGAACAGGTGGG - Exonic
1165347629 19:35258851-35258873 CCTTCCCAGCACACCCAGGAGGG - Intronic
1167605400 19:50479154-50479176 CCTTCCCTCCAGGCCCAGGTGGG + Intronic
925010475 2:481586-481608 GCTTCCGTGCAGGCACCGGAAGG - Intergenic
925132087 2:1501424-1501446 CCTTCCCAGGATGGACAGGAAGG - Intronic
925460202 2:4055661-4055683 GCTTCCCTGCTTTCACAGAAAGG - Intergenic
925901536 2:8512656-8512678 CCCTCCATGCATGCACACCAAGG - Intergenic
925971643 2:9110538-9110560 CCATCTCTGCAGGCACAGAAGGG - Intergenic
926018614 2:9475080-9475102 CATTCCCTGCGGGCACAGGTGGG + Intronic
926217366 2:10913782-10913804 CCTTCCCCGCAGGCTCTGGAGGG - Exonic
927487705 2:23500126-23500148 CCTTCCCAGCATGGTCTGGAAGG + Intronic
927695825 2:25239125-25239147 CCTTCCCGGTATGAACAGGTTGG - Exonic
929564497 2:42976054-42976076 ACTTCTCTGCATGCACAGCCTGG - Intergenic
931128599 2:59305617-59305639 TCCTGCCTGCATGCAAAGGAAGG + Intergenic
932729704 2:74210110-74210132 ACTTCCAAACATGCACAGGATGG - Intronic
933774839 2:85765708-85765730 CCTTCCCTGGGTGAAGAGGAGGG - Intronic
936086818 2:109474869-109474891 CCTTCCCTGCTGGCTCTGGAGGG - Intronic
937912376 2:127081849-127081871 CCCCACCTGCCTGCACAGGAAGG + Intronic
941673903 2:168323861-168323883 CCTTCCCTGCATCCACCAGAGGG - Intergenic
947551311 2:231048658-231048680 CCTTCCCTGCCTGATGAGGATGG + Exonic
947782151 2:232777768-232777790 CATTCCCTGCATGTACTGGTAGG + Intronic
947793297 2:232879675-232879697 CCTCCCCTCCCTGCACAGGGTGG - Exonic
947834423 2:233164920-233164942 CCTTCCTTACAAGCACAGGCGGG + Intronic
1168813931 20:723863-723885 CTCTCACTGCACGCACAGGAAGG + Intergenic
1169089846 20:2852242-2852264 CCAACCCTGGAAGCACAGGAGGG + Intronic
1169273810 20:4219890-4219912 GCCTCCCTGGAGGCACAGGAAGG - Intergenic
1169447934 20:5688058-5688080 ACTTCCTTGCATGAGCAGGAAGG - Intergenic
1172019150 20:31900697-31900719 CCTTCCCTGGATCCAGAGAACGG + Intronic
1172052957 20:32133202-32133224 TCTTCTCTGCAACCACAGGATGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173289742 20:41704049-41704071 CAATCTCTGCATGCACAGGCAGG - Intergenic
1174189489 20:48730058-48730080 CCTTCCCTGGAGCCCCAGGAGGG + Intronic
1175074654 20:56362401-56362423 ACTGTCCTGAATGCACAGGACGG - Intronic
1175903666 20:62369729-62369751 CCTGTCCTGAATCCACAGGAGGG + Intergenic
1176012223 20:62904215-62904237 CCCTCTCTGCATTCACAGGTGGG + Intronic
1176042763 20:63073872-63073894 CCTCCCCTCCCTGCACAGGCTGG + Intergenic
1179921612 21:44510526-44510548 CCTTGCTTGTATGCTCAGGACGG + Intronic
1180027700 21:45177347-45177369 ACTTCCCCGCATGCCCAGGCTGG + Intronic
1180498513 22:15911453-15911475 CATTCCCAGGATGCACAGGGTGG + Intergenic
1181629892 22:24145249-24145271 GCTGCCCTGAATGCACTGGAGGG + Intronic
1181952058 22:26561756-26561778 CTATCCCAGCAGGCACAGGAAGG + Intronic
1182054108 22:27336277-27336299 CTTTCCTTGAATGCACAGCAGGG - Intergenic
1183189296 22:36311478-36311500 ACATCCTAGCATGCACAGGAGGG + Intronic
1183972526 22:41488653-41488675 CCTTACCTGCATGTACATGAAGG + Intronic
1184355655 22:43977860-43977882 CCTTCCCTGCAGGAACTGGCAGG + Exonic
1184944941 22:47796252-47796274 CCCTTCCTGGATGCACAGAAGGG - Intergenic
953691535 3:45124065-45124087 CCAACCCTGCCTGCCCAGGAAGG - Intronic
955088265 3:55724244-55724266 CCTTCCCAGCCTGCACATGGTGG + Intronic
955648210 3:61163613-61163635 CCTTTCCTCCAGGCATAGGAAGG - Intronic
963142706 3:141960946-141960968 CCTTCCCTCCACTCAAAGGAAGG + Intronic
965657802 3:171007359-171007381 CCCTCCCTGAATTCACTGGAAGG + Intronic
966306459 3:178541156-178541178 TTTCCCCTGCCTGCACAGGAGGG + Intronic
966735147 3:183181693-183181715 CATCCCCTGCATGAATAGGAAGG + Intronic
968073467 3:195802496-195802518 CCTGCCCTGCCTGCCCTGGAAGG + Intronic
968762167 4:2448381-2448403 CCTTCTCTGCATCCACAGGGTGG + Intronic
968948377 4:3677404-3677426 CCTTCCCGGTGAGCACAGGATGG + Intergenic
973823142 4:54680720-54680742 AATTCCCTGCAGGCTCAGGAGGG - Intronic
974519807 4:62968723-62968745 CTTTACCTGCATGCACTGGATGG - Intergenic
975715745 4:77204122-77204144 CCTTCCATCCAAGCACAAGAAGG - Intronic
976316648 4:83665706-83665728 GCTTCCCTATCTGCACAGGATGG - Intergenic
981637488 4:146897537-146897559 CCTCCCCTGCATGATCAGCAGGG - Intronic
982354666 4:154453113-154453135 TTTTGCCTGCATGCACGGGATGG - Intronic
983123635 4:163920667-163920689 CATTCCCTGCCCCCACAGGATGG + Intronic
984564649 4:181313502-181313524 CCTTCCCTATTTCCACAGGAAGG + Intergenic
985636369 5:1037809-1037831 CCTGCTTTGCTTGCACAGGAGGG - Exonic
986739816 5:10696142-10696164 CTTTCCCTGGATGCAAAGAAGGG + Intronic
988489256 5:31692737-31692759 CCTGCCCTGCATGTACAAGAAGG - Intronic
990381803 5:55226890-55226912 TCTTCCCCGGATGCACAGGCGGG - Exonic
993810570 5:92470873-92470895 CCTTCCCTCAGGGCACAGGATGG + Intergenic
995708317 5:115008558-115008580 CCTTCACTGCATCTACAGCAGGG + Intergenic
998097324 5:139403613-139403635 GTTTCTCTGCCTGCACAGGAGGG + Intronic
999104475 5:149058708-149058730 CCTCCCCAGCATGCGCAGGCTGG - Intronic
1001544759 5:172564077-172564099 CCCTCCCATCATGCACAGGGTGG + Intergenic
1002224945 5:177713775-177713797 CCTGCCATTCATGAACAGGAAGG - Intronic
1004285763 6:14318994-14319016 TTTTCCCTGCATGCTGAGGAAGG + Intergenic
1004784879 6:18957162-18957184 TCATCCCTGCAGGCAGAGGATGG - Intergenic
1007179315 6:39917016-39917038 CCTTCCCTGTCGGCACGGGAAGG + Intronic
1007435132 6:41805212-41805234 CCTTCCCTGTATGTAAAGAAGGG + Intronic
1008738262 6:54573879-54573901 CCTTCCCTAAGTGTACAGGATGG - Intergenic
1011459719 6:87590279-87590301 CCTTCCCTGGCTGGAGAGGAGGG + Intronic
1015602481 6:134924009-134924031 GATTCCCTGCATGCACAGCTTGG + Intronic
1018468016 6:164069558-164069580 CCATTCCTGACTGCACAGGATGG + Intergenic
1020240164 7:6388219-6388241 CCTCCCCAGCCTGCACAGGGAGG - Intronic
1021811802 7:24409585-24409607 TCTTCCCTCCATTAACAGGATGG - Intergenic
1022482831 7:30755155-30755177 CCTTCCCTTAATCCCCAGGATGG - Intronic
1022834218 7:34098302-34098324 CTCTCCCACCATGCACAGGAGGG + Intronic
1024584000 7:50825155-50825177 CCTTCCCTGCCTGCCCCGTAAGG + Intergenic
1027744918 7:82061279-82061301 TTTTGCCTGAATGCACAGGAAGG - Intronic
1028154848 7:87418281-87418303 GATTCCCTGCAGTCACAGGATGG - Intronic
1029132152 7:98339778-98339800 CCTTCACTGCAGGCCCAGCATGG + Intronic
1029535456 7:101154900-101154922 CCTTCCCGGGCTGCACAGGCGGG + Intronic
1029696349 7:102215940-102215962 CCTTTCCTGCAGGCACATGGTGG - Intronic
1030296528 7:107934441-107934463 CCTTCCTTGAAAACACAGGAAGG + Intronic
1030473906 7:110003569-110003591 CCTTCCCTTCATCCTCAGGTAGG - Intergenic
1030687950 7:112505877-112505899 CCTTCCTTGCAGGCACGGGCTGG + Intergenic
1031569010 7:123334936-123334958 CCTTCCCTGCTTCCACAGGCTGG - Intergenic
1031818993 7:126474694-126474716 CCTCCCCTGCAAGCCTAGGAAGG - Intronic
1031832055 7:126639617-126639639 TCTTCCCTGCAAGCCTAGGAAGG + Intronic
1032644885 7:133812551-133812573 CCTACCCTTCATGGGCAGGAAGG - Intronic
1033155571 7:138954370-138954392 CCATTCCTGCAGGGACAGGATGG + Intronic
1034285552 7:149881152-149881174 ACTTCCCTGGAGGGACAGGAGGG + Intergenic
1035265218 7:157686233-157686255 TCTTCCCTCCACGCCCAGGACGG + Intronic
1035628390 8:1090413-1090435 CCTGCCCTGCCTGGCCAGGAGGG - Intergenic
1036642233 8:10591749-10591771 CCTGCCCTCCATGTGCAGGAGGG + Intergenic
1036699489 8:11002583-11002605 CCCTCCCAGCCAGCACAGGAAGG + Intronic
1037914024 8:22761129-22761151 CCTCCCCAGCAAGCACAGGTGGG + Intronic
1037951216 8:23019657-23019679 CCTTCCCTGCATCCCCACCAGGG - Intronic
1039888826 8:41671009-41671031 CCTTCCCTGCACTCAGCGGAGGG + Intronic
1040041544 8:42920564-42920586 CCTGCCCTTCATGAACAAGAAGG + Intronic
1042013840 8:64284498-64284520 CCTTCCCTCCAGGTACAGGGTGG - Intergenic
1042468800 8:69159968-69159990 CTTTCCCTTCATTCACAGGCAGG + Intergenic
1042605505 8:70541836-70541858 CCTTGCCTGCTTTCACAGGCTGG - Intergenic
1045111050 8:98940061-98940083 CCTTCCCTGGAGTCACCGGAAGG + Intronic
1045587492 8:103555023-103555045 CCTTCCCTCCATGCTCAAGTAGG - Intronic
1048311845 8:133328861-133328883 ACTTCTCTGCATGCAGAGGCAGG + Intergenic
1048823113 8:138397861-138397883 CCTTCCTTGCAGGCACACCAGGG - Intronic
1049198654 8:141329372-141329394 CCATCCCAGCTTGCACCGGAGGG + Intergenic
1051868272 9:21707113-21707135 CCTTCACAATATGCACAGGAGGG + Intergenic
1053061494 9:35035847-35035869 CCTGCCCTGCCGGCCCAGGATGG - Intergenic
1053387834 9:37708767-37708789 CATTCCCTGCATGCTTAGCACGG - Intronic
1054855913 9:69899513-69899535 TCTTCTCTGCACACACAGGATGG - Intronic
1056115891 9:83440895-83440917 CCTCTCCTTCAGGCACAGGACGG + Intronic
1057281994 9:93719999-93720021 CCATCCCAGAAGGCACAGGAGGG - Intergenic
1057550641 9:96049180-96049202 CCCTCCCTGCCCGGACAGGATGG + Intergenic
1058913662 9:109544354-109544376 CATCCCCAGCATGCAAAGGATGG - Intergenic
1059999092 9:119942202-119942224 CCCTGCCTGCATGCAAAGGGAGG - Intergenic
1060513245 9:124249289-124249311 CCTCCTCTGCATGCCCAGTAGGG - Intergenic
1060514823 9:124258829-124258851 CCCTCTCTGCATACACAGGCTGG + Intronic
1061681615 9:132245254-132245276 CCAGCCCTGAATGCACAGGCCGG - Intergenic
1062378797 9:136276923-136276945 CCTGCCCTGCATGTCGAGGAAGG + Intergenic
1187478778 X:19635771-19635793 ACTTCCATGCAGGGACAGGAGGG - Intronic
1187905818 X:24065423-24065445 TCTTCCCTTAATGCCCAGGATGG - Intronic
1189196804 X:39160343-39160365 CCCTCCCTGCATGGGCAGGGTGG + Intergenic
1195279032 X:103311171-103311193 CTTCCCCTGCTTGCCCAGGAAGG + Intergenic
1196990182 X:121320277-121320299 CCATCCCTGCCTTCTCAGGAAGG - Intergenic
1197391046 X:125865141-125865163 CCTTCCCTTCAAGGCCAGGAAGG + Intergenic
1198509547 X:137336419-137336441 CCTTCCCTGGATGCAAACCAGGG + Intergenic
1200010414 X:153115921-153115943 CCTCCCCTGCAGCCTCAGGAGGG + Intergenic
1200029186 X:153284001-153284023 CCTCCCCTGCAGCCTCAGGAGGG - Intergenic
1200230420 X:154441202-154441224 ACTGCACTGCATGCACGGGAAGG - Intronic