ID: 905885128 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:41487658-41487680 |
Sequence | CTCAAGACACTGATGGGGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905885118_905885128 | 25 | Left | 905885118 | 1:41487610-41487632 | CCCATTTGGTAGATGAGATAACT | No data | ||
Right | 905885128 | 1:41487658-41487680 | CTCAAGACACTGATGGGGCTGGG | No data | ||||
905885119_905885128 | 24 | Left | 905885119 | 1:41487611-41487633 | CCATTTGGTAGATGAGATAACTG | No data | ||
Right | 905885128 | 1:41487658-41487680 | CTCAAGACACTGATGGGGCTGGG | No data | ||||
905885117_905885128 | 30 | Left | 905885117 | 1:41487605-41487627 | CCACTCCCATTTGGTAGATGAGA | No data | ||
Right | 905885128 | 1:41487658-41487680 | CTCAAGACACTGATGGGGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905885128 | Original CRISPR | CTCAAGACACTGATGGGGCT GGG | Intergenic | ||
No off target data available for this crispr |