ID: 905885128

View in Genome Browser
Species Human (GRCh38)
Location 1:41487658-41487680
Sequence CTCAAGACACTGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905885118_905885128 25 Left 905885118 1:41487610-41487632 CCCATTTGGTAGATGAGATAACT No data
Right 905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG No data
905885119_905885128 24 Left 905885119 1:41487611-41487633 CCATTTGGTAGATGAGATAACTG No data
Right 905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG No data
905885117_905885128 30 Left 905885117 1:41487605-41487627 CCACTCCCATTTGGTAGATGAGA No data
Right 905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905885128 Original CRISPR CTCAAGACACTGATGGGGCT GGG Intergenic
No off target data available for this crispr