ID: 905886364

View in Genome Browser
Species Human (GRCh38)
Location 1:41494159-41494181
Sequence TCCCCAAGGCTGATCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905886355_905886364 -1 Left 905886355 1:41494137-41494159 CCGCTTGCCCCCCACCCGGCACT 0: 1
1: 0
2: 4
3: 51
4: 628
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168
905886359_905886364 -10 Left 905886359 1:41494146-41494168 CCCCACCCGGCACTCCCCAAGGC 0: 1
1: 0
2: 5
3: 21
4: 297
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168
905886356_905886364 -8 Left 905886356 1:41494144-41494166 CCCCCCACCCGGCACTCCCCAAG 0: 1
1: 1
2: 6
3: 126
4: 3718
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168
905886352_905886364 20 Left 905886352 1:41494116-41494138 CCTGGGAGCCTTGGGAGTCAACC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168
905886357_905886364 -9 Left 905886357 1:41494145-41494167 CCCCCACCCGGCACTCCCCAAGG 0: 1
1: 0
2: 3
3: 28
4: 350
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168
905886353_905886364 12 Left 905886353 1:41494124-41494146 CCTTGGGAGTCAACCGCTTGCCC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905886364 Original CRISPR TCCCCAAGGCTGATCCAGAG AGG Intergenic
900094689 1:935528-935550 ACCCCACGGCTGCTCCAGGGAGG - Intronic
900266987 1:1762356-1762378 TCCCAAATGCAGATCTAGAGAGG - Intronic
900685093 1:3943218-3943240 TCCCGAAGGCTGAGTCCGAGAGG - Intergenic
900923500 1:5688891-5688913 TCCCCAAAGGTGACCCAGTGTGG + Intergenic
901496694 1:9626467-9626489 CCCCCAAGGCTGCTGGAGAGGGG + Intergenic
902196180 1:14800144-14800166 ACCCCAAGGCTGACCCAGCATGG + Intronic
903271566 1:22191803-22191825 TCCCCACTGCAGATCCAGAGAGG - Intergenic
903390275 1:22959066-22959088 TCCCAAAGGCAGCTCCACAGAGG - Intronic
903469844 1:23579065-23579087 TCACCACGCCTGATGCAGAGTGG - Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
908169562 1:61491384-61491406 TCCCCAAGGGTGAAACAGGGAGG + Intergenic
911521068 1:98931557-98931579 TCCCCAAGGCTGAGGGAGAAAGG - Intronic
913986433 1:143569995-143570017 TCCCCAGGCCTGGTCCAGAGAGG - Intergenic
915159632 1:153908834-153908856 TCCCCAAGGCTGGAACACAGTGG + Intronic
915558950 1:156675506-156675528 TCATCTTGGCTGATCCAGAGGGG - Intronic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
918813518 1:189151571-189151593 GCACCAAGTCTGTTCCAGAGAGG + Intergenic
920193703 1:204212262-204212284 TCCTCAAGGCAGATCCAGCATGG + Intronic
922758632 1:228110125-228110147 TCCGAAAGGCTGATACAGCGGGG + Intergenic
1063830106 10:9942746-9942768 TCCCCAAAGCAGACCCTGAGAGG + Intergenic
1065972899 10:30819071-30819093 GCCGCAAGGCTATTCCAGAGTGG + Intergenic
1067068543 10:43116825-43116847 CCCCCAATGCTGTTCTAGAGCGG + Intronic
1070437402 10:76406659-76406681 TACACAAGGCTGATTCAGGGTGG + Intronic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1071241103 10:83706104-83706126 TCCCCAAAGCTGAAGCAGAAGGG + Intergenic
1073352765 10:102831603-102831625 TCACCGATGCTGCTCCAGAGTGG + Exonic
1073830456 10:107377551-107377573 TCCTCAAGGATGTCCCAGAGAGG + Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1076786257 10:132751483-132751505 TCCCGCAGGCAGAGCCAGAGAGG - Intronic
1077179115 11:1204326-1204348 TCCCCCAGGCTGATGGAGAAGGG + Intergenic
1078403065 11:11044899-11044921 TCCCCCAGGCTGGAGCAGAGTGG - Intergenic
1084096044 11:66912322-66912344 TCCTCAAGTCTGTTCCAGGGGGG - Intronic
1084968432 11:72756424-72756446 TCCCCAGGGCTGGCCCAGGGTGG - Intronic
1085623885 11:78057462-78057484 TCCCAAAGTCTGAGCTAGAGAGG + Intronic
1088598251 11:111455633-111455655 TCCCTAAGTCTGATCCAGGTTGG - Intronic
1089992139 11:122871446-122871468 TCCCCCAGGCTGGTCCACTGAGG - Exonic
1090843788 11:130514646-130514668 TCCCCAACTCTGCTCCAGGGGGG + Intergenic
1092298312 12:7220372-7220394 TCCCCAAGGGTGATCCTGAAAGG + Intergenic
1092451341 12:8605267-8605289 ACCGCAAGGCTGAGCCCGAGGGG - Exonic
1094492257 12:30968286-30968308 TCCCAAAGAATGACCCAGAGGGG + Intronic
1096048700 12:48586936-48586958 TCCACAAGGCCGGTCCAGAAGGG + Intergenic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1096147148 12:49286468-49286490 TCCCGAAGGCTGGAGCAGAGAGG - Intergenic
1099934715 12:89111123-89111145 TCCCTATGCCTGACCCAGAGTGG - Intergenic
1104729739 12:131098243-131098265 TCCCCAAGTCCAATCCCGAGCGG + Intronic
1105505717 13:21008080-21008102 TCCCCACGGTGGAGCCAGAGTGG - Intronic
1111408769 13:87846039-87846061 TGGTCAAGACTGATCCAGAGGGG + Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1121446551 14:93982543-93982565 TTCCCAAGGGTGATTCAGACAGG - Intergenic
1121463883 14:94102019-94102041 GCCCCGAGGCTGAACCAGGGAGG + Intronic
1122076315 14:99237414-99237436 TCCCCAAGGCAGGACCAGAGAGG + Intronic
1123834179 15:24171095-24171117 CTCCCAAGACTGAACCAGAGAGG + Intergenic
1126416612 15:48424399-48424421 TCCCCACGGAGGATCCAGATTGG - Intronic
1126614615 15:50564207-50564229 TCACCCAGGCTGAAGCAGAGGGG - Intronic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1129269565 15:74412192-74412214 CTTCCAAGGCTGATCCAGAGAGG + Intronic
1132587469 16:711815-711837 TCCCCAGGCCTCCTCCAGAGAGG - Intronic
1133102018 16:3485541-3485563 TCCCCAGGGCTGACCCAGTGTGG + Exonic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1134619203 16:15674968-15674990 TCTCCAAGCCTCATCCACAGGGG - Intronic
1138546471 16:57722577-57722599 GCCCCAAGCCTGATCCAGGGAGG - Intronic
1140023840 16:71265452-71265474 TCCCCCATCCTGGTCCAGAGTGG + Intergenic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1142020789 16:87780911-87780933 TCCCGAAGGCTGAGCCTGTGGGG - Intergenic
1142558206 17:793892-793914 TCCCAAAGGCTGGTGCAGAGAGG + Intergenic
1142685808 17:1576404-1576426 TCCCCAAATCAGGTCCAGAGAGG + Intronic
1143484682 17:7247174-7247196 TCACCTGGGCTGAACCAGAGTGG + Exonic
1150283710 17:63943953-63943975 TCCTCCAGGCTGATCAACAGGGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152253597 17:79224586-79224608 TCCCCTGAGGTGATCCAGAGTGG + Intronic
1152460105 17:80438181-80438203 TCCCCAAGGCTGCTCTGGGGAGG + Intergenic
1152890987 17:82881567-82881589 ACCCCAAGGCTCAAGCAGAGGGG - Intronic
1156291836 18:35754577-35754599 TCCCCAAGGTGGTTCCTGAGGGG + Intergenic
1156309241 18:35907630-35907652 TCCCAGAAGCTGACCCAGAGTGG + Intergenic
1159016489 18:63105249-63105271 TCCCCCAGGCCGGTCCTGAGAGG - Intergenic
1159149020 18:64496113-64496135 TCCCCAAGTCTGATACCCAGAGG - Intergenic
1160907363 19:1457770-1457792 TTCCCAAGGCTGAGTGAGAGAGG + Intronic
1161568458 19:5016669-5016691 TCCCCAGGGCCGATGCAGACAGG - Intronic
1162876598 19:13625259-13625281 TTCCCAAGGCTGAGCCAAAATGG + Intergenic
1166151868 19:40880702-40880724 TCCCCAAGGGTGGAGCAGAGGGG + Intronic
1166178297 19:41089951-41089973 TCCCCAAGGGTGGAGCAGAGAGG - Intronic
1166420714 19:42633915-42633937 TCCCCAAGGCTGATGCAGCAGGG + Intronic
1167576933 19:50322299-50322321 TCCCAAAGAGAGATCCAGAGAGG - Intronic
925481137 2:4275919-4275941 TGACCAAGGCTGAGGCAGAGAGG + Intergenic
925911756 2:8578353-8578375 ACCCCAAGGGAGATCCAGAAGGG + Intergenic
926893614 2:17660238-17660260 TTCCCAAGGCTGGGCCAGAAAGG - Intergenic
927047748 2:19297050-19297072 TCATCAAGGCTGATCAAGAATGG + Intergenic
927180013 2:20438802-20438824 CCCCCAATGCCTATCCAGAGGGG - Intergenic
929012347 2:37457306-37457328 TACCCAAGGCTGAGCCCCAGAGG - Intergenic
930237979 2:48905979-48906001 GCCCAAAGGCTGACCCAGAAAGG + Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
932271501 2:70413941-70413963 TCCCCAAGGATGACCCACTGGGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933247925 2:79996660-79996682 TCCTCAAGGCTTTTCCAAAGGGG - Intronic
937343160 2:121104801-121104823 TCCCCAAGACAGAGGCAGAGTGG - Intergenic
939402853 2:141716951-141716973 TCCCCCAGCATGATCCACAGGGG + Intronic
940159255 2:150693725-150693747 ACCTAAAGGCTGATCCATAGTGG + Intergenic
944708774 2:202316998-202317020 TCCCCAAGGCTTTTCCAGTAGGG + Intergenic
945673755 2:212832091-212832113 TCCTCAGCGCTGATCCAAAGAGG - Intergenic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
948594019 2:239068028-239068050 CCCCTAACGCTGATCCTGAGAGG + Intronic
948749647 2:240124313-240124335 TCCCCCAGGCCCCTCCAGAGTGG + Intergenic
1170620344 20:17990495-17990517 TCCCCAGGGTTCACCCAGAGGGG + Exonic
1170645117 20:18190953-18190975 TCCCCAAGGCTTAGCCAGAGCGG - Intergenic
1170780276 20:19419599-19419621 TCCCTCAGGCAGATCCTGAGGGG + Intronic
1171723813 20:28595942-28595964 TCCACAAGGCCCATGCAGAGTGG + Intergenic
1173003674 20:39123634-39123656 TCTCCAAGCCTGGTCCAGAGAGG - Intergenic
1174477156 20:50803751-50803773 TCCCCAAGGCTGAAGTACAGTGG - Intronic
1174599561 20:51713236-51713258 TCCCTAAGACAGATTCAGAGAGG - Intronic
1175166665 20:57048887-57048909 TCCCCCAAGCTCCTCCAGAGGGG - Intergenic
1176057390 20:63155880-63155902 ACCCCAAGCCTGATCCCCAGTGG + Intergenic
1176310513 21:5146543-5146565 TCCCCCAGGCTGTTCCCGTGTGG - Intronic
1177402411 21:20623271-20623293 TCCACAAGGCTGTTCCAAAGTGG + Intergenic
1178305320 21:31486240-31486262 TTCCCCAGGATGATCCAGAGTGG - Intronic
1178319215 21:31592247-31592269 TCCCCCATGCTGAACCATAGTGG - Intergenic
1179846542 21:44115492-44115514 TCCCCCAGGCTGTTCCCGTGTGG + Intronic
1180201498 21:46227496-46227518 ATCCCAAGGGTGATCCAGGGTGG + Intronic
1180297369 22:10954633-10954655 TCCACAAGGCCCATGCAGAGTGG + Intergenic
1181716408 22:24733240-24733262 TCCCCCAGGATGATCTTGAGGGG - Intronic
1182264118 22:29099243-29099265 TCCCCTAGGCTGCTTCTGAGCGG - Intronic
1183414203 22:37673332-37673354 GCCGCAAGGCGGACCCAGAGAGG - Intergenic
1185070037 22:48651197-48651219 GCCCCAGAGCTGAGCCAGAGGGG + Intronic
950274465 3:11646850-11646872 TACCCAAGTGTGATCCAGAGGGG + Intronic
952710528 3:36427377-36427399 TTTCCAAGGCTGGCCCAGAGGGG - Intronic
953850450 3:46462613-46462635 TCTCCAATGCTGATCCAGGGAGG + Intronic
955993814 3:64657374-64657396 TCTCCAAGGCTGATGCACAGTGG + Intronic
959406361 3:105966268-105966290 GCCTCTAGCCTGATCCAGAGCGG - Intergenic
962266395 3:133947413-133947435 TCCCCAAGGCTGCAGCAGGGAGG + Exonic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
963639026 3:147836397-147836419 TCCCCAAGGCTGGTCCAAGAAGG - Intergenic
964681537 3:159345472-159345494 TCCCCAAGGCAGAGCCAGGAAGG + Intronic
964928192 3:161982638-161982660 GCTCCACGGCAGATCCAGAGGGG - Intergenic
965647914 3:170903360-170903382 TTCACTAGGCTGATCCACAGAGG - Intronic
965856301 3:173092080-173092102 CCCACAGGGCTGATCCAGATGGG - Intronic
966723456 3:183087573-183087595 TCCTCAAGGATGATCAAGACTGG + Intronic
966734826 3:183180145-183180167 TCCCTAAGGCTGCTCCAGCAGGG - Exonic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968086646 3:195876877-195876899 TCCCCAGGGGTGACTCAGAGTGG - Intronic
971094735 4:23387911-23387933 TCCCCAAGACTGGTCCAGGGTGG - Intergenic
973291505 4:48475799-48475821 TCTCCAAGTCTGTACCAGAGGGG - Intergenic
974077750 4:57183051-57183073 TCCCCCAGCCTCATCCAGGGTGG - Intergenic
979532331 4:121781813-121781835 TCCCCATGGATGATACACAGAGG - Intergenic
981825422 4:148935278-148935300 TCCCCTATGCTGAAGCAGAGGGG + Intergenic
984756321 4:183328730-183328752 TCACCAGGACAGATCCAGAGGGG + Intergenic
991711936 5:69416517-69416539 TCCCCAAGGCTAAGCTGGAGGGG + Intronic
995945452 5:117639529-117639551 TCACCGAGGCTAAGCCAGAGTGG + Intergenic
996872321 5:128205000-128205022 TCCCCAAGGAAGATACAGAATGG - Intergenic
996923978 5:128800588-128800610 TCACCCAGGCTGATTCAGAGAGG - Intronic
997398025 5:133580222-133580244 TCCACAAAGCTGAGCCACAGAGG - Intronic
998424876 5:142018091-142018113 TCCATAAGGCTGCTCCAGTGTGG - Intergenic
999475868 5:151898527-151898549 TCCCCTCTGCTGACCCAGAGTGG - Intronic
999751840 5:154633365-154633387 TCTCCCAGGCTGATGCACAGTGG + Intergenic
1000889686 5:166787780-166787802 TCCCCAAGGGTGATGTGGAGTGG + Intergenic
1001933798 5:175690813-175690835 TCACACAGGCAGATCCAGAGAGG - Intergenic
1002097239 5:176838770-176838792 TCCCCAGGGCTTTTCAAGAGAGG - Intronic
1006152814 6:31998356-31998378 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1006159122 6:32031093-32031115 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1006230443 6:32581670-32581692 TCCACAGGCCTGATCCAGAATGG - Exonic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1007735976 6:43982411-43982433 TCTACAAGCCTGAGCCAGAGTGG + Intergenic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1021981494 7:26059763-26059785 TCCCCAAGTGAGATCCGGAGGGG - Intergenic
1024600886 7:50980478-50980500 TCGCAAAGGCTGATCCAAATAGG + Intergenic
1025168900 7:56738037-56738059 TCCCCAAGGCTGGTGTACAGTGG - Intergenic
1025703489 7:63841860-63841882 TCCCCAAGGCTGGTGTACAGTGG + Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1028354310 7:89887468-89887490 GCCCCAGGGCAGATCCAGAAAGG + Intergenic
1030431278 7:109452284-109452306 TCCTTTAGCCTGATCCAGAGCGG - Intergenic
1034877553 7:154738963-154738985 TCCCCATCCCTGATCTAGAGTGG - Intronic
1038278454 8:26141357-26141379 TCCCCCAGGCTGGAGCAGAGTGG - Intergenic
1038802888 8:30765311-30765333 TCACCAAGGCTGAAGCACAGTGG + Intronic
1040289654 8:46117786-46117808 TCCCCAAGGCTGTCCCAGGCAGG - Intergenic
1041826696 8:62102713-62102735 TCCACAGGGCTGGTCCAGAAAGG + Intergenic
1044926221 8:97210778-97210800 TTACCTAGGCTGAGCCAGAGAGG + Intergenic
1046344326 8:112902666-112902688 TCCATAAGGCTCATCAAGAGGGG - Intronic
1048625690 8:136182623-136182645 TCCTCAAGGCTCATGCAAAGAGG - Intergenic
1049656734 8:143802400-143802422 TCCCAGAGGCTGTTACAGAGAGG + Intronic
1050036808 9:1445001-1445023 TCCCCAAGTCCGTTTCAGAGTGG - Intergenic
1057172928 9:92974812-92974834 TCCCCCAGGCACATACAGAGAGG - Intronic
1060148758 9:121273108-121273130 TTCCCAAGAGTGATCCAGAAAGG + Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1061083496 9:128386038-128386060 ACCCCCAGGCCTATCCAGAGTGG + Intronic
1061192657 9:129090760-129090782 TCCTCAAGGCTGTCCCACAGAGG - Intergenic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1187208391 X:17204753-17204775 TCCCACAGGATGATCCAAAGAGG - Intergenic
1187900672 X:24025043-24025065 TTCCCAGGACTTATCCAGAGGGG - Exonic
1190063877 X:47227230-47227252 CCCCCAAGGCTGACCCAAGGTGG - Intronic
1190713726 X:53087392-53087414 TCCCCCAGTCTGATCCAAAGAGG - Intronic
1194100136 X:89693801-89693823 TCCACAGGGCTGGTCCAGAAAGG - Intergenic
1194359629 X:92933687-92933709 TTCCCCAGGCTGGTCCAGAATGG - Intergenic
1194988484 X:100518305-100518327 TCCCACAGGGTGATGCAGAGGGG - Intergenic
1199232159 X:145448805-145448827 TCCCCATGGCTGAAGCAGGGTGG + Intergenic
1199717257 X:150515560-150515582 ACCTCAAGGCTGAGCCAGTGTGG + Intergenic
1200166347 X:154038257-154038279 TCCCCAAGGCTGTCCCCCAGGGG + Intronic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic