ID: 905888505

View in Genome Browser
Species Human (GRCh38)
Location 1:41504845-41504867
Sequence CCCTCCTTTTAGGCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905888496_905888505 22 Left 905888496 1:41504800-41504822 CCGTCACCAAATAGACACACTGA 0: 1
1: 0
2: 1
3: 25
4: 235
Right 905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 106
905888495_905888505 23 Left 905888495 1:41504799-41504821 CCCGTCACCAAATAGACACACTG 0: 1
1: 0
2: 1
3: 25
4: 297
Right 905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 106
905888497_905888505 16 Left 905888497 1:41504806-41504828 CCAAATAGACACACTGACTTCAT 0: 1
1: 0
2: 0
3: 16
4: 167
Right 905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905888505 Original CRISPR CCCTCCTTTTAGGCCACTGT GGG Intergenic
902114777 1:14112413-14112435 CACTCCTCTTTGGCCACTGTGGG + Intergenic
902820700 1:18941563-18941585 TCCTCCTTCTGGGCCCCTGTAGG - Intronic
904655484 1:32042567-32042589 CCCTCCTGCTAGGCCAGTGAAGG + Exonic
905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG + Intergenic
906217057 1:44048386-44048408 GCGTCCTTTTAGCTCACTGTGGG - Intergenic
906815307 1:48872838-48872860 CCTTCCTGTTAGGCCCCTGGGGG - Intronic
907099511 1:51816099-51816121 GCCACCTTTTAGCCCATTGTTGG - Intronic
907272134 1:53297405-53297427 CCCTACTGTCAGGACACTGTGGG - Intronic
907857004 1:58313417-58313439 CCATCCCTTTAGGCCATTGTGGG - Intronic
908025418 1:59946206-59946228 ACCTTCTTTTAGTCTACTGTTGG + Intergenic
911533542 1:99074669-99074691 CCCTGCTTTTAGGCAAATGTGGG + Intergenic
912501491 1:110125405-110125427 CCCTGCTTCTAGGCCAATTTGGG - Intergenic
915492352 1:156258130-156258152 CCATCCTTTGGGGCCCCTGTGGG + Intronic
920429862 1:205911595-205911617 CCCTCCTACTAAGCCTCTGTTGG + Intergenic
921682456 1:218050586-218050608 CCATCCCTAGAGGCCACTGTGGG - Intergenic
922774021 1:228206875-228206897 CCCTCCATGGAGGCCTCTGTGGG + Intronic
1064623951 10:17242987-17243009 TACTTCTTTTAGGGCACTGTAGG + Intergenic
1065297310 10:24289358-24289380 CTCTCCTCTCAGGCCTCTGTAGG - Intronic
1066842357 10:39941885-39941907 ACCTACTTTGAGGCCATTGTTGG + Intergenic
1069550472 10:69360601-69360623 CCCTCCTTTTACACTCCTGTTGG + Intronic
1081623099 11:44630758-44630780 CCATCCTTTTGGGCCACTGGTGG - Intergenic
1083950995 11:65956073-65956095 CCCTGCCTTAAGGCCACTGACGG + Intronic
1085246733 11:75107986-75108008 CCCTCCTTCAAGGTCACAGTTGG + Intronic
1086639666 11:89137534-89137556 CCTTCCTTTGAGGCAACAGTGGG + Intergenic
1090888216 11:130898107-130898129 CCCTCCTTCTAAGCCAAAGTTGG - Intronic
1091654217 12:2333503-2333525 CCTTCCCCTTAGGCCACTGTGGG - Intronic
1092488462 12:8923051-8923073 CCATCCTTCTAGTCCTCTGTGGG + Intronic
1096992576 12:55817320-55817342 CCCTCCTTTTTGCCCCATGTCGG - Intronic
1100363421 12:93898230-93898252 CCCTCCTCTTAGGGGCCTGTAGG + Intergenic
1102513471 12:113431083-113431105 CCCTCCCTTTTCTCCACTGTGGG - Intronic
1102531595 12:113550711-113550733 CCCTCCTTTTCCACCCCTGTAGG + Intergenic
1104892247 12:132145648-132145670 CCCTCCTTTCAGGTCAAGGTGGG + Exonic
1110114300 13:71792917-71792939 CTCTCATATTAGTCCACTGTAGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1118712809 14:68536465-68536487 CCTTCCATTTAGACCAATGTAGG - Intronic
1121585735 14:95061787-95061809 CCCTCCTCGCAGGCCTCTGTGGG - Intergenic
1122348886 14:101076562-101076584 CCCGCCTTTTAGGCGACCGTTGG - Intergenic
1122943978 14:104996658-104996680 CCGTCCTTTTTGGCCACTGGAGG - Intronic
1126694830 15:51317062-51317084 CCCTCCTTTTAGGATTCTTTTGG + Intronic
1127266686 15:57367849-57367871 CCCTCATTTCAGACCACAGTTGG - Intergenic
1130643104 15:85698016-85698038 TCCTTTTTTTAAGCCACTGTGGG - Intronic
1133077521 16:3291104-3291126 CACTCCTGTTAGGCCATCGTAGG - Exonic
1134396738 16:13872104-13872126 CCCTCCTTTTAAACCACATTTGG - Intergenic
1142624105 17:1181091-1181113 CCTTCCTGGTAGGCCTCTGTAGG - Intronic
1144220314 17:13093886-13093908 CCCTGCTTTTAGGCAAATGGAGG - Intergenic
1147185711 17:38712126-38712148 CCTTCCTCTGAGGCCACTGAGGG + Intronic
1148861406 17:50606190-50606212 CCCACTTTTTGGGGCACTGTGGG - Intronic
1149687042 17:58541887-58541909 CCCTCCTATGGGCCCACTGTGGG - Exonic
1151534151 17:74729331-74729353 GGCTCCTTCTCGGCCACTGTGGG + Intronic
1151939291 17:77282543-77282565 CCCTGCCTTTGGGCCATTGTCGG + Intronic
1154131455 18:11739982-11740004 ACATCCTTTTCGACCACTGTGGG - Intronic
1155059657 18:22217471-22217493 CCCTCCATTTGGGCCACGGAGGG + Intergenic
1156491304 18:37498094-37498116 CCTTCCCTTAAGGCCACTCTGGG - Intronic
1157692236 18:49692853-49692875 GCCACCTCTTAGGCCACTCTGGG + Intergenic
1161135123 19:2615095-2615117 CCCGCTTTCTAGGCCACTTTCGG + Intronic
1162473820 19:10888063-10888085 CCGACCTTCCAGGCCACTGTGGG + Intronic
1163527914 19:17832433-17832455 CCCTCCTGCCAGGCCACTTTAGG - Intronic
1165652400 19:37502777-37502799 GCCTCCTTTTAGGCCAAATTTGG + Intergenic
925154949 2:1641697-1641719 TCCTCCTCTCAGGGCACTGTGGG - Intronic
929946286 2:46375068-46375090 GCCACCTTTTGGGCCACTGAAGG - Intronic
936725308 2:115307590-115307612 CCCAACTTTCAGACCACTGTAGG + Intronic
938121700 2:128638606-128638628 CCTTCCTTTTAGCCCAGTGAGGG + Intergenic
942647973 2:178135290-178135312 CACTCTTTTTTTGCCACTGTTGG - Intronic
942889524 2:180971291-180971313 CAATCCTTTCATGCCACTGTGGG + Intronic
945046262 2:205784548-205784570 TCATCCTCTTAGGCCACAGTTGG - Intronic
946841518 2:223824823-223824845 CCTTCCTTTTAGGCCAGTTGCGG - Intronic
1168840059 20:904202-904224 CCCTCCCTACAGGCCACTGAGGG + Intronic
1170153327 20:13247623-13247645 CCCACCATCTAGGCCTCTGTAGG + Intronic
1170476031 20:16715273-16715295 CTTTCATTTTAGGCCACTGGAGG - Intergenic
1172082467 20:32353010-32353032 CCTTCCTTTGAGGCCATTCTAGG + Intergenic
1174886975 20:54346518-54346540 CCCTGATTTTAGGCCAATGGGGG + Intergenic
1176004423 20:62852447-62852469 TCTTCCTTTTAGGCCACTGAGGG + Intronic
1178142819 21:29702909-29702931 CTGTCGTTTTAAGCCACTGTTGG + Intronic
1180699057 22:17771945-17771967 CACACCTGTTAGGCCACTGGGGG - Intronic
1180731735 22:17987474-17987496 CTCTCCCTCTAGGCCACTGCTGG + Intronic
1180879910 22:19196291-19196313 CCCTCCTTCCAGGCCTCAGTGGG + Exonic
1183832714 22:40427187-40427209 CCCTAGTTATAGGCCAGTGTAGG - Intronic
1184151785 22:42643730-42643752 GCCTCCTTTAAGGCCCCAGTTGG + Intronic
950035256 3:9880370-9880392 CCCTCCTTTTAGGCCTTTTCTGG - Intergenic
953318054 3:41947015-41947037 CCTTCATTTTAGGACACTGCTGG - Intronic
954229255 3:49203727-49203749 CCCTCCTTTCTGGCAACTGGAGG - Intronic
959688875 3:109177214-109177236 TCCTCATTTTAGGCTACTATAGG + Intergenic
961888762 3:130112628-130112650 CCCTCCTTTTGGGCCCCAGACGG - Intronic
969226133 4:5799598-5799620 CGCTCGCTTCAGGCCACTGTAGG + Intronic
970369004 4:15389282-15389304 CCCTGCCTTTAGGCCACTGGGGG - Intronic
971383159 4:26118419-26118441 CCCACCTGTTTGGCCACAGTTGG - Intergenic
973934653 4:55831327-55831349 TCTTCCTTTTTGGTCACTGTAGG - Intergenic
979940413 4:126755566-126755588 CCCCTCTTTTAGATCACTGTTGG + Intergenic
984718947 4:182952548-182952570 CCCTCTACTTAGGCCCCTGTGGG - Intergenic
996319090 5:122193758-122193780 CTGTCCTTTGAGGACACTGTTGG - Intergenic
997744198 5:136284645-136284667 AACTCCTGTTAGGGCACTGTCGG - Intronic
999061130 5:148637051-148637073 CCCCCATTTTAGGACCCTGTGGG - Exonic
999809069 5:155110798-155110820 CCAGCCTTTCAGGTCACTGTGGG - Intergenic
1002191077 5:177477985-177478007 CCTTCCTTTAAGGCCTCCGTTGG + Intergenic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1009553134 6:65125809-65125831 CCTTGCTTTTAGGCCAATTTAGG + Intronic
1010387845 6:75302992-75303014 CCCTCAATTTAGGCCATGGTAGG + Intronic
1010642836 6:78351884-78351906 CCCTCAATTTAGGCCTCTTTTGG - Intergenic
1011135282 6:84093411-84093433 CCCTCATTTTAGGGTCCTGTGGG - Intergenic
1011554044 6:88556479-88556501 CCTTTCTTTTAGGTCACTTTAGG + Intergenic
1013220865 6:108075759-108075781 ACCTGCTTGTTGGCCACTGTAGG - Intronic
1016613881 6:146024980-146025002 TCCTGCTTTTCTGCCACTGTGGG + Intergenic
1019802077 7:3095349-3095371 CCCCTCTTTTAAGCCTCTGTGGG - Intergenic
1020893672 7:13912230-13912252 CCCTCCTTTTCTCCCACTCTGGG - Intronic
1024763318 7:52627444-52627466 CCCTCCTTTTTCTCCTCTGTGGG - Intergenic
1025310989 7:57941893-57941915 TTTTCCTTTTAGGCCTCTGTTGG - Intergenic
1038981847 8:32768390-32768412 GCTGCCTTTTAGGCCACTATGGG - Intergenic
1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG + Intergenic
1047536024 8:125720108-125720130 CCCTCCTTTTAGGTCACATGAGG - Intergenic
1049406470 8:142453803-142453825 CCCCACTTCTAGGCCTCTGTAGG - Intronic
1049512790 8:143038146-143038168 CCCTCCTTTTGGGCCTGGGTTGG + Intergenic
1060405005 9:123368733-123368755 CCCTCCCTTTAGGCCATGCTGGG + Intronic
1062436509 9:136548746-136548768 CCCTCCTTTGCGGCTGCTGTGGG + Intergenic
1186620745 X:11237567-11237589 CCTTCCTTTTAGGCTAGGGTAGG - Intronic
1191645281 X:63473350-63473372 CTCTCTTTTTGGGCCACTGATGG - Intergenic
1192388434 X:70698474-70698496 GCCTCCTTTTTGGCTTCTGTTGG - Intronic
1194812466 X:98402910-98402932 CCTTCATTTAAAGCCACTGTTGG + Intergenic