ID: 905891525

View in Genome Browser
Species Human (GRCh38)
Location 1:41521396-41521418
Sequence TGCCCCCGCCACGGGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905891517_905891525 -10 Left 905891517 1:41521383-41521405 CCTCCCTCTCCTCTGCCCCCGCC 0: 1
1: 2
2: 22
3: 333
4: 3042
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891515_905891525 -2 Left 905891515 1:41521375-41521397 CCCATAGGCCTCCCTCTCCTCTG 0: 1
1: 0
2: 0
3: 29
4: 325
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891512_905891525 1 Left 905891512 1:41521372-41521394 CCCCCCATAGGCCTCCCTCTCCT 0: 1
1: 0
2: 2
3: 58
4: 461
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891511_905891525 9 Left 905891511 1:41521364-41521386 CCAGGGAGCCCCCCATAGGCCTC 0: 1
1: 0
2: 2
3: 16
4: 206
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891507_905891525 28 Left 905891507 1:41521345-41521367 CCTTTCTCAGGAGAAGGCACCAG 0: 1
1: 0
2: 5
3: 31
4: 233
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891513_905891525 0 Left 905891513 1:41521373-41521395 CCCCCATAGGCCTCCCTCTCCTC 0: 1
1: 0
2: 10
3: 73
4: 725
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891516_905891525 -3 Left 905891516 1:41521376-41521398 CCATAGGCCTCCCTCTCCTCTGC 0: 1
1: 0
2: 5
3: 86
4: 680
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138
905891514_905891525 -1 Left 905891514 1:41521374-41521396 CCCCATAGGCCTCCCTCTCCTCT 0: 1
1: 0
2: 2
3: 55
4: 516
Right 905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905891525 Original CRISPR TGCCCCCGCCACGGGGGTGC AGG Intronic
900117561 1:1035012-1035034 GGCCCCAGCCACAGGGGTGCAGG - Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
901465322 1:9417508-9417530 TGCCTCCATCACGGGAGTGCTGG + Intergenic
902279316 1:15362765-15362787 TGCCCCCACCCAGGTGGTGCCGG - Intronic
904263342 1:29303794-29303816 TGCCCCAGCCTCGGGGGTCCTGG - Intronic
905328009 1:37171618-37171640 TGCCCATCCCACGGGGGTGTGGG + Intergenic
905847016 1:41241938-41241960 TGACCCCGGCCCGGGGGAGCAGG + Intronic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
906107625 1:43304380-43304402 TGCCTCCACCACGAGAGTGCAGG - Intronic
908261053 1:62339480-62339502 TGCCCCAGCCCCAGGGCTGCTGG + Intergenic
910251113 1:85200622-85200644 AGCCCCCGCCACGTGGAGGCAGG - Exonic
921364120 1:214357826-214357848 TGCTCCCCCCACAGGGGTGCAGG - Exonic
923116788 1:230947845-230947867 AGCCCCGGCCACGGGTGTGCGGG - Intronic
1066337058 10:34488673-34488695 AGCCCCGGCCACAGCGGTGCTGG - Intronic
1066654142 10:37683409-37683431 TGCCCCCACCACGGGCCTGGGGG - Intergenic
1073432262 10:103494178-103494200 TCCGCCCGCCACGGGTGTCCTGG - Exonic
1073531066 10:104232312-104232334 TTCCGCCGCCGCGGGGCTGCGGG + Exonic
1075650854 10:124127798-124127820 TGGCCCAACCAAGGGGGTGCAGG + Intergenic
1076793650 10:132788810-132788832 TGCAGACGCCGCGGGGGTGCCGG - Intergenic
1076898850 10:133327194-133327216 TGGCCCCTCCACTGGGGTTCTGG + Intronic
1076944973 10:133640547-133640569 TTCCCCAGCCCCGGGGGCGCGGG - Intergenic
1076998459 11:310747-310769 CGCCCCCACCACGGGGGAGCAGG - Intronic
1076999512 11:315707-315729 TGCCCCCACCCCAGGGGAGCAGG - Intergenic
1077000284 11:319012-319034 CGCCCCCACCACGGGGGAGCAGG + Intergenic
1077308314 11:1877547-1877569 TGCCCCGACAACGGCGGTGCCGG - Intronic
1079243969 11:18739900-18739922 TCCACCCTCCACAGGGGTGCCGG - Intronic
1083334247 11:61913535-61913557 TTCCCCCGCCAGGGGTGGGCTGG - Intronic
1083891579 11:65598305-65598327 TGCCCAGGCCCCGTGGGTGCCGG - Exonic
1085341585 11:75734919-75734941 TGTCCCTGCCACGTGGCTGCTGG - Intergenic
1090403772 11:126465405-126465427 TGCTGCAGCCCCGGGGGTGCTGG + Intronic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1092291268 12:7160589-7160611 TGACCCCACCGCAGGGGTGCAGG - Intergenic
1096384718 12:51187572-51187594 TTCCCCAGGCATGGGGGTGCAGG - Exonic
1096546237 12:52342020-52342042 TGTCCCCACCACGGAGGAGCAGG - Intergenic
1100984218 12:100189378-100189400 CCCCCCTGCCACGGGTGTGCAGG + Intergenic
1101842819 12:108340277-108340299 TGCCCCCCCGACGTGGGTGGTGG - Intergenic
1103631600 12:122266149-122266171 TGCCTCCTGCACAGGGGTGCAGG + Intronic
1103945405 12:124523363-124523385 TGCCCCTGCCACCGGGGTGTGGG - Intronic
1103958573 12:124593368-124593390 GGCCCAGGCCCCGGGGGTGCAGG - Intergenic
1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG + Intronic
1107250171 13:38350264-38350286 TGGCCCCGTCACGAGGGTGTGGG + Intronic
1108727812 13:53201187-53201209 TGGCGCCGCCACGCTGGTGCCGG + Intergenic
1121320644 14:92989769-92989791 TGCCTCTGCCTAGGGGGTGCGGG + Intronic
1122938774 14:104972002-104972024 TGCCCCCGCCACGGGATGCCAGG + Intronic
1122982580 14:105198323-105198345 TGGCCCAGCCATGGGGGTGAGGG + Intergenic
1124146232 15:27127920-27127942 TGAGCCAGCCACGTGGGTGCTGG + Intronic
1125155398 15:36579642-36579664 AGTCCCCGCCGCGGAGGTGCCGG + Exonic
1126777548 15:52112604-52112626 TGGCGCCGGCTCGGGGGTGCCGG + Exonic
1129740203 15:77986330-77986352 TGCCCCCTCCATGGCGGGGCAGG + Intronic
1132292793 15:100714885-100714907 GGCCCTCGCCATGGGGATGCTGG + Intergenic
1132618672 16:854385-854407 AGCCCCCAGCACGGGGGTCCAGG - Exonic
1132955865 16:2593137-2593159 TGCCACAGGCACGGGCGTGCAGG - Intronic
1133162321 16:3920373-3920395 TCCCACCGCCACGGTGGAGCTGG + Intergenic
1133749425 16:8713073-8713095 TGACCCCGCCTCGGGGGTTGGGG - Exonic
1135424613 16:22326073-22326095 TTCCCGAGCCACAGGGGTGCTGG - Exonic
1136406840 16:30053196-30053218 TGCCCGCGGCCCGAGGGTGCAGG + Exonic
1136519458 16:30786707-30786729 TGCCCCGGCCCCCGGGGTCCCGG + Intronic
1137251269 16:46742734-46742756 TGCCTCCCCCACGCCGGTGCTGG - Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1140985312 16:80153038-80153060 TGCACCCACCACTGGGGTGCGGG + Intergenic
1142261279 16:89043553-89043575 TGCCCCAGCCCGGGAGGTGCTGG - Intergenic
1143762516 17:9115670-9115692 TGTCCCCGCCCCGGGGGGGAAGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1147045125 17:37745831-37745853 TGGCCACGCCACTGGGGAGCTGG + Intergenic
1147211243 17:38873751-38873773 TGCCCCGGCCAGGGTGGGGCTGG + Intronic
1147948404 17:44093244-44093266 TGCCCCTGCCATGGGGGGTCTGG - Intronic
1150128450 17:62653374-62653396 AGACCCCGCCCCGGGGGTGGGGG - Intronic
1152336504 17:79702265-79702287 TGCCCCTGCCTCGGGCCTGCAGG - Intergenic
1152516447 17:80827584-80827606 TGGCCCCTCCCTGGGGGTGCAGG - Intronic
1152618013 17:81346555-81346577 TGGCCCCGCGTCGGGGGTGCGGG + Intergenic
1154303909 18:13217502-13217524 AGCCCCCGCCACGGCGGCCCCGG + Intronic
1160849568 19:1183859-1183881 GGCCCCTGCCACGTGAGTGCAGG + Intronic
1160949323 19:1658023-1658045 TGCCCCCGCCTCGGGGTAACTGG - Intergenic
1161574502 19:5048180-5048202 TGCCCCTGCCCGGGAGGTGCCGG + Intronic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1164536227 19:29088154-29088176 TGCCCCAGCCACGGGGTGGCAGG + Intergenic
1165104718 19:33462125-33462147 AGCCCCGGCCCTGGGGGTGCTGG - Intronic
1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG + Exonic
1167577137 19:50323173-50323195 TGCCCCCGCTGCCGTGGTGCGGG + Exonic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
926010189 2:9400861-9400883 TGCTCTAGCCAGGGGGGTGCAGG + Intronic
926152415 2:10432533-10432555 TGACCCCGCCACTGCGGCGCAGG + Intergenic
927117103 2:19916265-19916287 TGCCCACGCCACCGGGGCCCTGG + Intronic
929346881 2:40895291-40895313 TGCCCCTGCCTCTGGGGTGAGGG - Intergenic
929537470 2:42792647-42792669 AGCCCCCACCACGGGGTCGCGGG - Intergenic
935130186 2:100255769-100255791 TACCTCCTCCACGGGGCTGCTGG + Intergenic
935622363 2:105141407-105141429 TGCCCACCCCAGGGAGGTGCTGG + Intergenic
936938207 2:117858676-117858698 TGCCCCGGCCAGGGGGCTTCGGG - Intergenic
937201746 2:120208585-120208607 TGCAGCCGCCACAAGGGTGCAGG - Intergenic
937208520 2:120252652-120252674 TGCCCCAGGCACGGGGGGGCGGG - Intronic
948672784 2:239579203-239579225 TGCCCGGGCCACAGGGGTCCAGG - Intronic
948822777 2:240558216-240558238 TGCCCCCATCACGGGAGTGTTGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1170606890 20:17881617-17881639 AGCCCCCGCCATGGTGGTGGAGG + Intergenic
1171455807 20:25271577-25271599 CGCCCCCGCCAGGGGACTGCAGG + Intronic
1172056420 20:32157645-32157667 TGCCCCCACCACAGGGCTCCTGG - Intronic
1172625438 20:36343976-36343998 TGTTCCGGCCATGGGGGTGCAGG + Intronic
1174171334 20:48619891-48619913 TGTCACCGCCACGGGGCTGATGG - Intergenic
1174868795 20:54164393-54164415 AGCTCCAGACACGGGGGTGCTGG + Intronic
1176545702 21:8197097-8197119 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1176564653 21:8380142-8380164 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1180826372 22:18864906-18864928 TCCCCCCGCCAGGTTGGTGCCGG - Intergenic
1181055124 22:20257220-20257242 TGCCCTTGGCACTGGGGTGCTGG - Intronic
1181108284 22:20587351-20587373 TGCCAGCGGCACAGGGGTGCCGG - Exonic
1182454861 22:30443849-30443871 GGCCCCCTCCACTGAGGTGCTGG - Intergenic
1183397603 22:37581247-37581269 TGCCACCGCCACGAGGGAACTGG + Intronic
1183486236 22:38089068-38089090 TGCCCCCGCCCCGGGGCGGCAGG - Intronic
1183669467 22:39264012-39264034 TGCCCCTGCCTCTGGGGTGGGGG - Intergenic
1183748160 22:39704165-39704187 TGCCCCCGCCAGGAGGGAGCTGG + Intergenic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185139346 22:49091709-49091731 AGCCCCCGCCACCCGGATGCTGG + Intergenic
1185315382 22:50176756-50176778 TCCCCCCACCACGGTGGTGTGGG - Intronic
1203250573 22_KI270733v1_random:113334-113356 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
950270457 3:11610549-11610571 TGACCTCGCCTCGGGGGAGCCGG + Intronic
954509164 3:51106591-51106613 TGCCCCTGCACCAGGGGTGCTGG + Intronic
961651490 3:128418708-128418730 CACCCCGGCCACAGGGGTGCTGG - Intergenic
963236652 3:142963303-142963325 TGCCCGCGCCCCGGGGCTGCAGG + Exonic
966355055 3:179071367-179071389 TGCCCCCGCCCCGTGGGAGTCGG - Intronic
969528948 4:7719309-7719331 AGCGCCCGCCACGGAGGCGCTGG - Intronic
969637589 4:8378278-8378300 TGGCCCCGGCACGGGCGAGCTGG + Intronic
975415452 4:74099312-74099334 TGGCCCCGCCTCTGGGGTGGAGG + Intergenic
983077498 4:163343916-163343938 TGCCGCCACCGCCGGGGTGCAGG + Intronic
985448355 4:190041056-190041078 TTCCCCAGCCCCGGGGGCGCGGG - Intergenic
985532666 5:443184-443206 TGCCTCCGCCTCCGGGGTCCCGG - Exonic
995650112 5:114361180-114361202 CGCCCCCGCCAGGGGGGACCCGG + Intronic
997980832 5:138466466-138466488 AGCCGCGGCCATGGGGGTGCTGG + Intronic
999002667 5:147940610-147940632 TGCCCCTGCCAGGGAGGTGGGGG + Intergenic
999399482 5:151253337-151253359 TGGCCCAGCTACGGGTGTGCGGG + Intronic
1001568430 5:172715083-172715105 TGCCCCAGCCCCAGGGCTGCAGG + Intergenic
1002082085 5:176743299-176743321 CGTCCCTGCCCCGGGGGTGCGGG + Intergenic
1003272080 6:4616039-4616061 TGCCCCAGCCACTGGGGACCAGG + Intergenic
1003425854 6:5997672-5997694 TGCCCCCGCCTCAGGCGGGCCGG - Intergenic
1017914204 6:158819162-158819184 TCCACCTGCCCCGGGGGTGCCGG + Intronic
1018260026 6:161960964-161960986 TGCCACAGCCACTGGGGTTCAGG - Intronic
1019614588 7:1953389-1953411 GGCCCCCGCCAGGGAGGAGCAGG + Intronic
1023093822 7:36640475-36640497 TGCCCCGGCCTCAAGGGTGCTGG - Intronic
1023806735 7:43877815-43877837 TGATCCCTCCTCGGGGGTGCAGG - Exonic
1029709378 7:102291272-102291294 TGCCACCGCCACGGGAGGGTGGG - Intronic
1034469552 7:151248127-151248149 TGCCCCTGCCCTGGGGGTGGGGG - Intronic
1037581743 8:20249580-20249602 TGCCCTCCCCTCGGGGGTCCTGG + Exonic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1047956931 8:129983691-129983713 TGCACCAGCCACAGGGATGCGGG + Intronic
1049341993 8:142118130-142118152 TGCACCCCCCACCGGTGTGCGGG + Intergenic
1056154018 9:83817454-83817476 TGCCTACGCCTCCGGGGTGCCGG + Intronic
1057035042 9:91805836-91805858 TGCCCTCCCCATGAGGGTGCAGG + Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057489572 9:95510878-95510900 TGCCCCGGCCGCGCGGGCGCGGG - Intronic
1060534757 9:124375939-124375961 TGTCCCTGCCACGGGGGCTCAGG - Intronic
1060899556 9:127245364-127245386 TGCCACGCGCACGGGGGTGCAGG + Intronic
1061455323 9:130693282-130693304 TGCGGCCGCCCCGTGGGTGCTGG - Intergenic
1062600087 9:137315607-137315629 TGCCCCCTCCCCCGGGGTGGGGG - Intronic
1203466975 Un_GL000220v1:96606-96628 TCTCCCCGCCTCAGGGGTGCTGG + Intergenic
1185874486 X:3691421-3691443 TCCCCCCGCCCCGGGGGAGTGGG + Intronic
1190258498 X:48783069-48783091 CGCCCCCTCCACGGGGATGGGGG + Intergenic