ID: 905891741

View in Genome Browser
Species Human (GRCh38)
Location 1:41522322-41522344
Sequence CCATTGCCACCATCCCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905891732_905891741 20 Left 905891732 1:41522279-41522301 CCCCCATACTGCAGAGAGAGTTA 0: 1
1: 0
2: 1
3: 7
4: 109
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202
905891733_905891741 19 Left 905891733 1:41522280-41522302 CCCCATACTGCAGAGAGAGTTAA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202
905891731_905891741 26 Left 905891731 1:41522273-41522295 CCTTCACCCCCATACTGCAGAGA 0: 1
1: 0
2: 2
3: 25
4: 238
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202
905891735_905891741 17 Left 905891735 1:41522282-41522304 CCATACTGCAGAGAGAGTTAACA 0: 1
1: 0
2: 0
3: 8
4: 134
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202
905891734_905891741 18 Left 905891734 1:41522281-41522303 CCCATACTGCAGAGAGAGTTAAC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202
905891730_905891741 27 Left 905891730 1:41522272-41522294 CCCTTCACCCCCATACTGCAGAG 0: 1
1: 0
2: 1
3: 18
4: 173
Right 905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG 0: 1
1: 0
2: 2
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905891741 Original CRISPR CCATTGCCACCATCCCAACC TGG Intronic
901661450 1:10800357-10800379 CCAAGGCCACCGTGCCAACCTGG - Intergenic
902636985 1:17740994-17741016 CCACAGCCACCACCCCGACCAGG - Intergenic
903169250 1:21541898-21541920 CCATTGACAGCACCCCATCCTGG - Intronic
903471971 1:23593632-23593654 CCATTCCCACCCTCCCTGCCAGG - Intronic
903809684 1:26028487-26028509 CCATTGCCTGCAACCCAGCCAGG - Intronic
905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG + Intronic
907604078 1:55798880-55798902 CCATTGCCACCATTCATCCCTGG - Intergenic
909828873 1:80160321-80160343 CCAGTTCTACCATCCCACCCAGG - Intergenic
909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG + Intronic
911745861 1:101441377-101441399 GCATTGTCACCAAACCAACCTGG - Intergenic
912680803 1:111727611-111727633 CCTCTGCCACCCTCCCAACAAGG + Exonic
912964526 1:114226356-114226378 CCCCTGCCCCCATCCCATCCTGG - Intergenic
915239172 1:154507627-154507649 CTATTGACACCTCCCCAACCCGG + Intronic
915580503 1:156809984-156810006 CCACTGCCTCCATCCAACCCTGG - Intronic
916966381 1:169947439-169947461 CCCTTGCAAATATCCCAACCTGG + Intronic
920441805 1:205985769-205985791 CCATCCCCATCATCCCCACCAGG + Intronic
920441813 1:205985787-205985809 CCAGGCCCACCATCCCCACCAGG + Intronic
920441825 1:205985814-205985836 CCAGGCCCACCATCCCCACCAGG + Intronic
921126115 1:212179577-212179599 CCCATGCCACCACCCCAGCCTGG + Intergenic
921539737 1:216399052-216399074 CCATCTCCACCACCCCTACCTGG + Intronic
1065855496 10:29826955-29826977 CCATCACCCCCATCCAAACCAGG + Intergenic
1067947153 10:50696772-50696794 CCATTTCCACCATCACAGCAAGG + Intergenic
1069623525 10:69852674-69852696 CCCAGCCCACCATCCCAACCAGG - Intronic
1070290866 10:75112223-75112245 CCATCACCACCAGCCCCACCCGG - Intronic
1070436297 10:76397201-76397223 CCATTGCTACCAACCAGACCAGG + Intronic
1070882462 10:79861760-79861782 CCATTTCCACCATCACAGCAAGG + Intergenic
1071649034 10:87378071-87378093 CCATTTCCACCATCACAGCAAGG + Intergenic
1075341072 10:121647249-121647271 CCATTGCCCCCATCCTATCACGG - Intergenic
1075752407 10:124783792-124783814 CACTTGCCACCAACCAAACCTGG + Intronic
1078307096 11:10200172-10200194 CCAGTTCCACCATTCCATCCTGG + Intronic
1078390077 11:10929771-10929793 ACAATGCCACCATCCTACCCTGG - Intergenic
1079072763 11:17362579-17362601 CCAGTGAAACCATCCGAACCTGG + Intronic
1080652536 11:34234157-34234179 CCCTTGCCCCCACCCCAACAGGG - Intronic
1082770513 11:57204075-57204097 CCATTGCCACCTACTCAATCAGG + Intergenic
1083209772 11:61175985-61176007 CCATTGGCATCATCTCAAGCTGG - Intergenic
1083678907 11:64342432-64342454 CCATTGCCTCCCTCCCAACCCGG + Intronic
1084483920 11:69437263-69437285 CCACTGCCCCCACCCCAGCCAGG + Intergenic
1085053794 11:73392768-73392790 CCAAGGCCACCATCCGACCCTGG - Intronic
1085301385 11:75460876-75460898 CCCTTGCCACCACCCCAACAGGG + Intronic
1085534463 11:77209685-77209707 CCATCACCACCTTCCCAACCTGG + Intronic
1088764795 11:112963689-112963711 CCATTGTCACGCTCCCACCCGGG - Intronic
1089398516 11:118151317-118151339 CCATTGCCACCATGGGGACCTGG + Intronic
1089689918 11:120180848-120180870 CCAGTGCCCCCACCCCAACAAGG + Intronic
1092226481 12:6751640-6751662 CCATTCCCAGCATCCCAAAGGGG + Exonic
1092500828 12:9045116-9045138 CCACTGCCACCCTCACAACAAGG + Intergenic
1095889540 12:47222881-47222903 CCGTTGTAACCATCCAAACCAGG + Intronic
1096073193 12:48787454-48787476 CAACTGCAACCATCCCACCCTGG + Intronic
1096571159 12:52524101-52524123 ATCTTGCCCCCATCCCAACCTGG + Intergenic
1100744225 12:97627863-97627885 TCTTTGCCACCTTCCAAACCTGG - Intergenic
1102888174 12:116537330-116537352 CCAATGCCAGCTTCCCAACATGG + Intergenic
1103964146 12:124627515-124627537 CAATTCCCACCCCCCCAACCCGG + Intergenic
1105737858 13:23289977-23289999 CCATTGCTACCACCCAATCCAGG - Intronic
1110037887 13:70711966-70711988 CCATTGTCACCCTCCTACCCAGG + Intergenic
1110534628 13:76637088-76637110 CCATTATCAACATCCCCACCAGG + Intergenic
1113372256 13:109734232-109734254 CCATTGCCAACATCCAGGCCAGG + Intergenic
1117083657 14:52177646-52177668 CCATCACCACCACCACAACCTGG + Intergenic
1117725343 14:58667773-58667795 CCATTCCCACCACACCCACCTGG - Intergenic
1118611692 14:67546463-67546485 CCATTGCAACCTCCCCATCCTGG + Intronic
1119407819 14:74409666-74409688 CCATGGCCCCTATCCCTACCCGG - Exonic
1119943399 14:78665768-78665790 CCATGGCCACCATCGCCTCCTGG - Intronic
1125522765 15:40357422-40357444 CCAGTGCCACCTCCCCCACCAGG - Intergenic
1125911891 15:43447622-43447644 TCATTGCCACCACCCTCACCAGG + Intronic
1127875608 15:63108901-63108923 CCATTGCTACTACCCCAGCCAGG + Intergenic
1128193342 15:65725984-65726006 CCATTACCACCCTCCCAAACCGG - Intronic
1131524461 15:93141912-93141934 CCATTGGCAGCACCCCATCCTGG + Intergenic
1132090597 15:98945336-98945358 CCATTGCTACCATCCCCTCCTGG + Intronic
1134123958 16:11603646-11603668 CCGCAGCCCCCATCCCAACCCGG + Intronic
1134568468 16:15271305-15271327 ACATTGTCACCCTCCCAGCCAGG - Intergenic
1134933536 16:18227226-18227248 ACATTGTCACCCTCCCAGCCAGG - Intergenic
1135968600 16:27055730-27055752 CCATTGCTGCCATCCCCACTGGG - Intergenic
1137507396 16:49065988-49066010 CCATTGTCATCATGCCTACCGGG - Intergenic
1138081312 16:54093797-54093819 CCTTTGCCCCCATCTCTACCAGG + Intronic
1138182911 16:54954903-54954925 CCTCTGCCCCCTTCCCAACCTGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141873883 16:86808415-86808437 CTGTTGCTACCATCCCATCCAGG + Intergenic
1142950234 17:3472266-3472288 CCATGGCCGCCATCTGAACCTGG - Intronic
1143527884 17:7482940-7482962 GCATTGCCATCATCACAGCCTGG + Exonic
1144207887 17:12992090-12992112 CCAATGACACCAGCCCAGCCAGG + Intergenic
1144853866 17:18257686-18257708 CCATCCCCACCACCCTAACCTGG - Intronic
1145867921 17:28252757-28252779 TCATCCCCACCATCCCAAGCAGG + Intergenic
1152556276 17:81054763-81054785 CCATCGCCCCCACCCCACCCAGG + Intronic
1152650630 17:81490896-81490918 CCAGTGCCCCCACCCCCACCTGG - Intergenic
1152815389 17:82404687-82404709 CCTTTGCCCTCATCTCAACCTGG + Intronic
1157002200 18:43540535-43540557 CCATTAGCAGCATCCCAACCTGG + Intergenic
1157812420 18:50706833-50706855 CCATTACCACCATCCTCACCAGG - Intronic
1158945230 18:62442128-62442150 CCATGCCCACCATCACACCCTGG - Intergenic
1162569037 19:11460259-11460281 CCACTGCCACTGTCCCACCCTGG + Intronic
1162569962 19:11465999-11466021 CCATTGCCCCCACCCCAGCTAGG + Intronic
1162812416 19:13172312-13172334 CCATTGCCACCACCCAACCCTGG - Intergenic
1163217103 19:15886979-15887001 CCAGTGCCACAATCCCACTCTGG + Intronic
1164852933 19:31499968-31499990 CCTCTTCCACCAGCCCAACCTGG - Intergenic
1165376317 19:35445141-35445163 TCAGTGCCATCATCCCTACCAGG - Intronic
925012445 2:496049-496071 ACCTTGCCACCCTCCCCACCCGG + Intergenic
925335316 2:3095000-3095022 TCACTGCCACTATCCCAACCAGG + Intergenic
926259132 2:11240647-11240669 GCATTTCCACCATCCCAAAGTGG - Intronic
927554402 2:24022116-24022138 CCATTCCCACAAGCCCTACCGGG - Intronic
931771557 2:65502110-65502132 CCAGTGCAACCAGCCCAACCAGG - Intergenic
931782404 2:65590118-65590140 CTATTGACCCCATCCCAACGTGG + Intergenic
934502208 2:94870246-94870268 CCATTCCCACCACCCCGCCCAGG - Intergenic
934925777 2:98380898-98380920 CCATTGTCCCCTTCCCCACCTGG - Intronic
934976136 2:98803858-98803880 CCATTTCCACCAGGTCAACCAGG - Intronic
935353673 2:102178027-102178049 ACATGGCCACCAGGCCAACCTGG - Exonic
935373480 2:102371572-102371594 CCAAAGCCACCCTCCCATCCTGG + Intronic
935632370 2:105222705-105222727 CCATAGCCACCCTGCCATCCTGG + Intergenic
938231135 2:129660270-129660292 CCTCTGAGACCATCCCAACCGGG + Intergenic
941992352 2:171569619-171569641 CCATTGCACCCAGCCCAACATGG + Intergenic
942503150 2:176613573-176613595 CCATTGCCAACATCTCCATCAGG - Intergenic
946281650 2:218670367-218670389 ACCTTACCACCATCCCATCCAGG - Intronic
947728472 2:232415439-232415461 CCTTTGCCCCCATCCCAAGGGGG + Intergenic
1168874862 20:1164455-1164477 CCATTGGGACCAGCCCACCCGGG + Exonic
1168984202 20:2033907-2033929 CCATTGCCACCAATCTAATCAGG + Intergenic
1168998293 20:2148578-2148600 GCCTTGCCACCCTCCCAAACAGG - Intronic
1169138694 20:3213932-3213954 CCATGATCACCATCCCCACCTGG - Intronic
1170095731 20:12643895-12643917 CCATTTCCACCATCTCAACATGG - Intergenic
1173965416 20:47108915-47108937 CCATCGCCAGGATTCCAACCTGG - Intronic
1174064101 20:47852263-47852285 CCACCTCCACCATCCCACCCTGG - Intergenic
1174068759 20:47885352-47885374 CCAAAGCCACCAACACAACCTGG - Intergenic
1174537090 20:51259694-51259716 CCAGTTCCGCCATCCCACCCAGG + Intergenic
1174772564 20:53314694-53314716 TCATTGCCACCTTCCCCTCCCGG + Intronic
1180092314 21:45539425-45539447 CCCCTGCCACCCTCCCAAGCCGG - Intronic
1180593222 22:16957856-16957878 CCATGGACACCATCCCATCCAGG + Intergenic
1182687466 22:32132295-32132317 CCCCTGCCACCCTCTCAACCAGG + Intergenic
1183345977 22:37308103-37308125 CCACAGCCAGCATCCCACCCTGG + Intronic
1183740759 22:39667272-39667294 CCTTTGGCACCATTCCCACCTGG + Intronic
1184213204 22:43049231-43049253 CCATGCCCAGCATCCCAAGCTGG - Intronic
1184895672 22:47405226-47405248 CCCTGGCCACCATCACACCCTGG - Intergenic
1184895796 22:47405708-47405730 CCCTGGCCACCATCACACCCTGG - Intergenic
1184896007 22:47407033-47407055 CCCTGGCCACCATCACACCCTGG + Intergenic
950520406 3:13494738-13494760 CCATGGCCACCAGCCCAGGCCGG - Intronic
950680285 3:14580406-14580428 CCATTGCGTCCAGCCCAGCCTGG - Intergenic
951036690 3:17940197-17940219 CGATTGCCACAGCCCCAACCAGG - Intronic
952981785 3:38742080-38742102 CCATTCCCACCAGCTCAGCCTGG + Intronic
954133805 3:48572896-48572918 CCACTGGCACCATCTCGACCTGG + Exonic
954425404 3:50440409-50440431 ACACTGCCACCATCCCAGGCGGG + Intronic
955023624 3:55145597-55145619 CCATTGCGATCAACCCAACATGG - Intergenic
956698736 3:71940418-71940440 CCATTCCCTTCATCCCAACTAGG + Intergenic
956763211 3:72461796-72461818 TCAATGACACCATCCCATCCTGG - Intergenic
958907682 3:99960084-99960106 CGATTGGCTCCATCCCGACCTGG + Intronic
963300701 3:143593995-143594017 CCATTGCCACCAACACAGACTGG - Intronic
963901570 3:150737982-150738004 CCATTGCCACCATCTGGGCCAGG - Intergenic
964408589 3:156375892-156375914 TCATTGCAACCATCCCCTCCTGG + Intronic
965507569 3:169533330-169533352 GCAATGCCACCATCACGACCTGG - Intronic
966516611 3:180828132-180828154 CCGCTGCCACCAGCCCAACCTGG - Intronic
968928581 4:3563220-3563242 CCAGTTCCGCCATCCCACCCAGG + Intergenic
969112405 4:4852115-4852137 CCACAGCCCCCACCCCAACCTGG - Intergenic
971471415 4:27030973-27030995 CCATCTCCACCATCACTACCTGG - Intergenic
972278701 4:37583348-37583370 CCATTGCTACCCTCCCAGCAAGG + Intronic
975328904 4:73091470-73091492 CCATCACCACCAGCCCAGCCAGG - Exonic
976009467 4:80469573-80469595 CCTTTGCTAGTATCCCAACCTGG - Intronic
981081327 4:140642142-140642164 CCTTTGCCACCATGCCACACAGG + Intronic
982636803 4:157907097-157907119 TCATTGCCTCCATCACTACCAGG - Intergenic
984382579 4:179014598-179014620 CCATTGACAGCATCCCACCAGGG + Intergenic
987309769 5:16670939-16670961 CCATGGCCACCATCCAGCCCCGG - Exonic
989437641 5:41433507-41433529 CCCTTTCCACCATCCCAAGATGG + Intronic
993790711 5:92207244-92207266 CCATTGCAGCCATCCCAGCCTGG - Intergenic
995434243 5:112118165-112118187 CCATTGCTACCCTACCAAGCAGG - Intergenic
996456516 5:123689978-123690000 CCATTTCTACCATCCAACCCAGG - Intergenic
996704933 5:126487995-126488017 CCATTGCCATCAGCACCACCTGG - Intronic
998908301 5:146930474-146930496 CCATTGCCACAATCCCTCCAGGG - Intronic
999977015 5:156921962-156921984 CCATTGTTCCCATCCCAGCCAGG - Intronic
1000388731 5:160701038-160701060 CCATTGCCACACACCCATCCAGG + Intronic
1003527673 6:6911496-6911518 TGGATGCCACCATCCCAACCAGG + Intergenic
1003958745 6:11190260-11190282 TCTTTGCCACCATCACAAACCGG + Exonic
1004290595 6:14363536-14363558 CCCTTCCCACCTCCCCAACCCGG - Intergenic
1005959588 6:30685998-30686020 CCATGGCCACCATCCCAGACTGG - Exonic
1006900689 6:37499099-37499121 CCACTTCCACCATCTCAGCCTGG + Intronic
1008320214 6:50103163-50103185 CCAGTGCCACAATCCAAAGCTGG + Intergenic
1011696394 6:89917518-89917540 CAATTGCCATCATCCACACCAGG - Intergenic
1012007923 6:93738986-93739008 CCTTTGCCACCATCCTATTCAGG + Intergenic
1014643472 6:123944231-123944253 CCAGTTCTGCCATCCCAACCTGG + Intronic
1016811322 6:148263830-148263852 CCATTTCCACCATCCAGACAGGG - Intergenic
1017726431 6:157279126-157279148 CCATTGCACCCAGCCCAATCTGG - Intergenic
1018400557 6:163415392-163415414 CCCTCCCCACCATCCCAAGCGGG - Intronic
1019304686 7:327632-327654 CCGTTGCCACAAGCCCACCCTGG - Intergenic
1020263115 7:6542364-6542386 CCATTGCCCCCAGCCCTGCCAGG - Intronic
1023025799 7:36048628-36048650 ACATTGCACCCCTCCCAACCTGG - Intergenic
1024862156 7:53857438-53857460 CCACTGCTACCATCCCAACCGGG + Intergenic
1025869064 7:65413946-65413968 CCACTGCGCCCAGCCCAACCAGG + Intergenic
1028314874 7:89388388-89388410 CCACTGCCACCTTCCCAATGAGG + Intergenic
1028628444 7:92904851-92904873 CACTTGCCACCTTCCAAACCTGG + Intergenic
1028865440 7:95706119-95706141 TCATTTCAACCATCCCAGCCTGG - Intergenic
1029220234 7:98982917-98982939 CCTTTGCCACCCTCCCTGCCCGG - Intronic
1032951645 7:136921354-136921376 CCATTTCAATCATCCAAACCCGG + Intronic
1034630952 7:152530212-152530234 CCATTACCATCATCCCATTCAGG - Intergenic
1036384660 8:8268757-8268779 CCATTGTCACCATCCCCATTGGG + Intergenic
1037707316 8:21326188-21326210 CCAGTGCCACCACCCACACCAGG + Intergenic
1038950011 8:32403937-32403959 CTGTTGCCACCTTCCCAAGCAGG + Intronic
1039158717 8:34592945-34592967 CCATTGCCACTCCCCCACCCCGG - Intergenic
1039233431 8:35474644-35474666 CGATTGGCACCATCACAGCCTGG + Intronic
1039966839 8:42290085-42290107 CCATCCCCACCACCCCCACCAGG - Intronic
1040467470 8:47708461-47708483 CCATTATCAACATCCCTACCAGG + Intronic
1041390255 8:57341468-57341490 CCACTTCCTCCATCCCAGCCAGG + Intergenic
1043695652 8:83213496-83213518 CCATAGCCACCACCACAACAGGG - Intergenic
1045499568 8:102734795-102734817 CCATTGCCTCCTTCCCTCCCAGG - Intergenic
1046591698 8:116214883-116214905 CCATTGTCATCATCACCACCAGG + Intergenic
1046638578 8:116700256-116700278 CTATTGCCACCATCCCAAGAAGG - Intronic
1047175646 8:122538042-122538064 CCATGGCAACCTTCCCAGCCTGG + Intergenic
1048987896 8:139745086-139745108 CCACGGCCACCATCCCCAGCAGG - Intronic
1049694236 8:143975857-143975879 CCACTGCCTCCATCCCAAACTGG + Intronic
1053061515 9:35035952-35035974 CCATTCCCACCAGCCCACCAGGG + Intergenic
1053152150 9:35749868-35749890 TCAGTGCCAGCATCCCCACCTGG - Exonic
1053803463 9:41778362-41778384 CCAGTTCCGCCATCCCACCCAGG + Intergenic
1054141800 9:61536762-61536784 CCAGTTCCGCCATCCCACCCAGG - Intergenic
1054191757 9:61989672-61989694 CCAGTTCCGCCATCCCACCCAGG + Intergenic
1054461557 9:65467937-65467959 CCAGTTCCGCCATCCCACCCAGG - Intergenic
1054646613 9:67598040-67598062 CCAGTTCCGCCATCCCACCCAGG - Intergenic
1055410919 9:76028522-76028544 CCATTTCTGCCATCCCACCCAGG - Intronic
1056575866 9:87855924-87855946 CCATTTCCACCATCACAGCAAGG - Intergenic
1057102645 9:92377493-92377515 CCCTTGCCACACTCCCTACCTGG - Intronic
1058084161 9:100731361-100731383 CCATGCCCACCATCACACCCTGG - Intergenic
1058764534 9:108168598-108168620 GCATCACCTCCATCCCAACCAGG + Intergenic
1059456319 9:114402438-114402460 GCAGTGCCCCCAACCCAACCTGG + Exonic
1060876653 9:127088888-127088910 CCATTGCCAGGAGCCCACCCTGG - Exonic
1061238678 9:129356911-129356933 CCAGGGCCACCTTCCCAAGCAGG + Intergenic
1062272762 9:135717400-135717422 CCAAGGCCACCATCTCCACCAGG - Intronic
1203563113 Un_KI270744v1:74131-74153 CCATTCCCACCACCCCGCCCAGG - Intergenic
1186816427 X:13242189-13242211 CCATTTCTGCCATCCCACCCAGG + Intergenic
1188526300 X:31091481-31091503 CCCATGCCACCATTCCAATCAGG - Intergenic
1190720513 X:53143771-53143793 CCATGCCCACCATCACACCCTGG + Intergenic
1195546974 X:106123780-106123802 CCATTGAAACCTTCCCAACTTGG - Intergenic
1195642175 X:107187991-107188013 CCAATGAAATCATCCCAACCTGG - Intronic
1197831827 X:130651223-130651245 TTATTGTCACCATTCCAACCAGG + Intronic
1201160319 Y:11160363-11160385 CCATTCCCACCACCCCACCCAGG + Intergenic