ID: 905900631

View in Genome Browser
Species Human (GRCh38)
Location 1:41580164-41580186
Sequence TCTGGCAAACCTCACCGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905900631_905900641 26 Left 905900631 1:41580164-41580186 CCTCTTCGGTGAGGTTTGCCAGA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 905900641 1:41580213-41580235 CTGAGCCTGGGGCTGTCCCATGG 0: 1
1: 1
2: 6
3: 48
4: 414
905900631_905900640 15 Left 905900631 1:41580164-41580186 CCTCTTCGGTGAGGTTTGCCAGA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 905900640 1:41580202-41580224 CTTCAAAGCTTCTGAGCCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 219
905900631_905900637 13 Left 905900631 1:41580164-41580186 CCTCTTCGGTGAGGTTTGCCAGA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 905900637 1:41580200-41580222 TCCTTCAAAGCTTCTGAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 230
905900631_905900639 14 Left 905900631 1:41580164-41580186 CCTCTTCGGTGAGGTTTGCCAGA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 905900639 1:41580201-41580223 CCTTCAAAGCTTCTGAGCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 187
905900631_905900642 27 Left 905900631 1:41580164-41580186 CCTCTTCGGTGAGGTTTGCCAGA 0: 1
1: 0
2: 0
3: 13
4: 94
Right 905900642 1:41580214-41580236 TGAGCCTGGGGCTGTCCCATGGG 0: 1
1: 0
2: 0
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905900631 Original CRISPR TCTGGCAAACCTCACCGAAG AGG (reversed) Exonic
905900631 1:41580164-41580186 TCTGGCAAACCTCACCGAAGAGG - Exonic
907650093 1:56286653-56286675 TCTGGCAAAACTGACCTAACAGG + Intergenic
910150821 1:84142292-84142314 TGTGGCAGACTTCACTGAAGAGG + Intronic
1064977265 10:21131171-21131193 TCTGCCAAAACTCACACAAGAGG + Intronic
1074038294 10:109762595-109762617 TCTGGCAAGCCTCACCACTGTGG - Intergenic
1077680297 11:4233746-4233768 ACTGGCAAATCTCACAGATGAGG - Intergenic
1077681188 11:4242160-4242182 ACTGGCAAATCTCACAGATGAGG + Intergenic
1077684575 11:4279165-4279187 ACTGGCAAATCTCACAGATGAGG - Intergenic
1077685466 11:4287603-4287625 ACTGGCAAATCTCACAGATGAGG + Intergenic
1077689708 11:4330323-4330345 ACTGGCAAATCTCACAGATGAGG - Intergenic
1077690618 11:4338764-4338786 ACTGGCAAATCTCACAGATGAGG + Intergenic
1079538317 11:21541579-21541601 AGTGACAAACCTCACTGAAGGGG + Intronic
1080902756 11:36510936-36510958 CCTGGAAAACCTCCCCTAAGAGG - Intronic
1080942931 11:36939509-36939531 TTTGGCTACCCTCACAGAAGGGG + Intergenic
1086161597 11:83727775-83727797 TCTGACTAAAATCACCGAAGTGG - Intronic
1096421376 12:51461182-51461204 TCTGGCAAAACACACAGAGGAGG - Exonic
1096758356 12:53818602-53818624 TCGGGCCAACCTCACCCAAGAGG + Intergenic
1097307059 12:58081048-58081070 TCTGGCAATCCTGGCAGAAGAGG + Intergenic
1097328965 12:58312459-58312481 TCTGGCTAACCTCACCTAATAGG + Intergenic
1098135843 12:67400954-67400976 TCTGGCAAACTTGACACAAGCGG - Intergenic
1106944650 13:34813553-34813575 TCAGGGAAACCTGACGGAAGGGG - Intergenic
1112053904 13:95671893-95671915 TTTGGCAAACCTCACCACCGTGG - Intergenic
1120662189 14:87263409-87263431 CCTAGCAAACCTCAGCGAAGTGG + Intergenic
1127132546 15:55882526-55882548 TCTGGCAAGCCTCACCACTGTGG + Intronic
1129268676 15:74408335-74408357 TCTGGCAAACCCCACAGGACTGG - Intergenic
1130697469 15:86144998-86145020 TCTGGCAACCCTCAGAGGAGAGG - Intronic
1133996536 16:10752739-10752761 ACTGTCAAACCTCAACAAAGAGG + Intronic
1134065643 16:11226242-11226264 TCAGGCAACCCTCTCCCAAGAGG - Intergenic
1134536992 16:15034288-15034310 TCTGGAAAACATGACAGAAGTGG + Exonic
1138439801 16:57027083-57027105 TCTAGCAAACCTCTGCCAAGAGG + Intronic
1139657680 16:68398864-68398886 TGTGGCAGAGCACACCGAAGTGG + Intronic
1140567048 16:76055796-76055818 TCTGGCAAGCCTCACCACAATGG - Intergenic
1144048534 17:11475994-11476016 TCTGCCAAAACTCACACAAGAGG - Intronic
1144214513 17:13043463-13043485 TCTGGCAAGCCTCACCTACTGGG + Intergenic
1145033912 17:19526678-19526700 TCATGAAAACCTCACTGAAGGGG - Intronic
1149153259 17:53594783-53594805 TTTGGCAAACCTCACCACTGTGG - Intergenic
1150823750 17:68457162-68457184 TGCGGCAAACCCCACTGAAGGGG + Intronic
1151842352 17:76627312-76627334 TCTGGCAAACCCCAGGGAAGAGG + Intronic
1153356690 18:4144249-4144271 TCTGGCAAGCCTCACCACTGTGG - Intronic
1153792385 18:8590815-8590837 TCTGCCAAAACTCACACAAGAGG + Intergenic
1155769272 18:29676288-29676310 ACTGGAAAACCTCAAAGAAGTGG + Intergenic
1165798222 19:38531626-38531648 TCCAGCAAACCTCACTGAATGGG + Intronic
1166564480 19:43755172-43755194 TCCCGCCAACATCACCGAAGAGG - Intergenic
1168411330 19:56141782-56141804 TCCCGCAAACCTTTCCGAAGGGG - Intronic
925396418 2:3536629-3536651 TCTGCAAAACCTCACTGGAGTGG + Intronic
931215037 2:60234272-60234294 CCTGACAACCCTCTCCGAAGGGG - Intergenic
931661688 2:64570798-64570820 TCTCACAAACCTCACAGAACTGG - Intronic
932842355 2:75095420-75095442 TCTGGACAACCTCACAGAAGAGG + Intronic
932858872 2:75267527-75267549 TCTGGCAAGCCTCACCACTGTGG - Intergenic
935705554 2:105853842-105853864 TCTGGCTAAACTGACCGAACAGG + Intronic
938688063 2:133760565-133760587 TCTGGCTGACCTCACCAAAGAGG - Intergenic
939779674 2:146430312-146430334 TCTGTCAAACCTCACCAAAAAGG + Intergenic
941524561 2:166590633-166590655 TCTGCCATAACTCACCCAAGAGG - Intergenic
947818907 2:233057337-233057359 TCTGGTCAACCTCACCCATGGGG - Intergenic
948658366 2:239491036-239491058 TCTCACAAACCTCACCTAAGGGG - Intergenic
949023788 2:241755509-241755531 GCTGGGACACCTCACAGAAGGGG - Intronic
1168900026 20:1355400-1355422 TCTGGCAAACCCCGCCAAAGTGG - Intronic
1173447644 20:43134456-43134478 TCTGGCTAAACTGACCTAAGAGG - Intronic
1174580987 20:51571468-51571490 TCTGGAAGACTTCACAGAAGAGG + Intergenic
1180135345 21:45858691-45858713 TCAGGAAGACCTCACTGAAGGGG - Intronic
1184356864 22:43987123-43987145 TCTGGCCAACCGCACGGAGGTGG - Intronic
951794610 3:26524339-26524361 TCCCACAAACCTCACCGCAGAGG - Intergenic
952651831 3:35736925-35736947 TTTGGCAAAGCTCCCTGAAGGGG + Intronic
956883365 3:73533847-73533869 TCAGGCTAACCTCACTGAAGAGG - Intronic
965527739 3:169739554-169739576 TCAGGCATATCTCACCAAAGGGG + Intergenic
966439139 3:179924156-179924178 TCAGGCAAATGTCACAGAAGTGG - Intronic
970580278 4:17468604-17468626 TCTGGCTTACTTCACAGAAGTGG - Intronic
972789011 4:42352771-42352793 TCTGGGAAATCTCAGCGAAGGGG + Intergenic
974092494 4:57326582-57326604 TCTGAAAAACTTCACAGAAGAGG - Intergenic
974601802 4:64092887-64092909 TCTGGCTAAACTCACTTAAGAGG - Intergenic
975330337 4:73105525-73105547 ACTGGTAAACCTCACAAAAGTGG + Intronic
980412893 4:132446664-132446686 GCTTGCAAACCTCACCACAGAGG + Intronic
983526809 4:168768084-168768106 TCGGGTAAACTTCACGGAAGAGG - Intronic
984719852 4:182959457-182959479 TCTGGCTAACCTGACCTAATAGG + Intergenic
986016370 5:3761106-3761128 TCAGGTAAACCTCCCCGAAACGG - Intergenic
986740217 5:10699477-10699499 TCTGGTAAACCTCACAGGTGTGG - Intronic
986817223 5:11426003-11426025 TCTGGCTAACCTGACCTAATAGG - Intronic
994444285 5:99854221-99854243 TCTGGCAACCCTCACTGAGTTGG - Intergenic
997311226 5:132885320-132885342 TCTGGAAGACTTCACAGAAGAGG + Intronic
997739712 5:136242953-136242975 TCTGGCAGACCTCAATGAAGAGG - Intronic
1005356168 6:24985481-24985503 TCTGGAAACCCTAACCCAAGTGG + Intronic
1007069490 6:39025437-39025459 TCTGTCAAACCTTGCTGAAGTGG - Intronic
1012892024 6:104907738-104907760 TCTGACAAGCCTCACCAATGTGG + Intergenic
1021131111 7:16913771-16913793 GCTGGCAAACCTCACCACTGAGG - Intergenic
1023852342 7:44157482-44157504 TCTTGCTGACCTCACCCAAGAGG + Intronic
1029667609 7:102005958-102005980 TCTGGCCAACCTCATCCACGCGG - Intronic
1031578040 7:123439470-123439492 GCTGGCAAAACTCACTGGAGGGG + Intergenic
1031665379 7:124476829-124476851 ACTGGCAAATCTCACAGATGAGG - Intergenic
1037813394 8:22099477-22099499 CCTGGCAAACATCACCCAATGGG - Intronic
1039451754 8:37680483-37680505 CGTGGCAAACCTGGCCGAAGTGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1044635530 8:94320043-94320065 TCTGGCAAGCCTCACCACTGTGG - Intergenic
1045019373 8:98028397-98028419 TCAGGAAAACCTCAGAGAAGAGG - Intronic
1045459003 8:102411485-102411507 GCAGGCAAACCTCACTGCAGGGG + Intronic
1048827071 8:138438692-138438714 TCTGGCAAAACCCACTGAACTGG + Intronic
1049607282 8:143535624-143535646 CCTGGCAAACATCACCGCAGTGG + Intronic
1050613506 9:7377739-7377761 TCTGGAAACACTCACTGAAGAGG - Intergenic
1050949304 9:11567437-11567459 TCTGGCAAACCTCACCACCATGG - Intergenic
1056516683 9:87358959-87358981 TCTGGCAAGCCTCACCTCTGTGG + Intergenic
1056565310 9:87766875-87766897 TCTGGCTAAACTCACCTAACAGG + Intergenic
1057150095 9:92788901-92788923 TATGGCTGACCTCACAGAAGTGG + Intergenic
1187984592 X:24796612-24796634 CCTGGCACAGCTCACTGAAGGGG - Intronic
1193172906 X:78357538-78357560 TCTGGAAAACCTTGCCGAAAAGG - Intergenic
1197995499 X:132368273-132368295 TCTGGCTAACCTGACCTAACAGG - Intergenic
1198818168 X:140614988-140615010 TCTTGCAAACCTCACCACTGAGG - Intergenic
1201774452 Y:17648225-17648247 TTTGGAAAACCTCCCAGAAGTGG + Intergenic
1201827104 Y:18257764-18257786 TTTGGAAAACCTCCCAGAAGTGG - Intergenic
1202049802 Y:20768600-20768622 TCTGGGAAACCTCCCCAAGGGGG - Intronic