ID: 905902956

View in Genome Browser
Species Human (GRCh38)
Location 1:41593955-41593977
Sequence CTGGCTGTTACCAGCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905902956 Original CRISPR CTGGCTGTTACCAGCTTTGC AGG (reversed) Intronic
901764169 1:11489418-11489440 CTGGGTGCCATCAGCTTTGCTGG - Intronic
905902956 1:41593955-41593977 CTGGCTGTTACCAGCTTTGCAGG - Intronic
907585825 1:55616934-55616956 CTAGCTGTTTCCTGCTTTGTTGG - Intergenic
908100407 1:60785477-60785499 CTGACTGTTGCCAGCTCTCCTGG - Intergenic
914397069 1:147279870-147279892 CTGGCTGTTACTATCTATGATGG + Intronic
916571248 1:166029674-166029696 CTGTCTGTTACCATTTTGGCAGG + Intergenic
917505132 1:175620528-175620550 CTGCTTGTTAGCAGCTCTGCTGG - Intronic
917571037 1:176265747-176265769 CTGGCTGGGGCCAGCATTGCAGG + Intergenic
920588738 1:207195849-207195871 CTGGCTGGGGCCAGCCTTGCAGG + Intergenic
922769113 1:228172567-228172589 CTGGCTGTTACCAGTATAGCTGG + Intronic
924622522 1:245674186-245674208 CGGTCTGTGACCAGCTTTACTGG - Intronic
1064110672 10:12535959-12535981 GTGGCTGTTAACTGCTGTGCTGG + Intronic
1065674348 10:28158093-28158115 CAGGGTGTTACCAACTGTGCAGG - Intronic
1065879964 10:30029571-30029593 TTGGCTGGTTCCAGCTTTCCAGG + Exonic
1067029636 10:42871559-42871581 CTGGCTCTCAGCAGCTCTGCAGG + Intergenic
1068902709 10:62287953-62287975 CTGCCTGTTACCATGTATGCAGG - Intergenic
1069608926 10:69759454-69759476 CTGCCTCTTACCAGCTTCGCAGG - Intergenic
1071018054 10:81021283-81021305 CAGCATGTTACCAGCTTTGGTGG + Intergenic
1077317195 11:1924876-1924898 CTGACAGTGACCAGCTCTGCTGG + Intronic
1078059466 11:8033899-8033921 CTGGCTGTTGCCAGCATTCTAGG + Intronic
1078417136 11:11175076-11175098 CATGCTTTTTCCAGCTTTGCAGG - Intergenic
1080254436 11:30273429-30273451 CTGTATGTCTCCAGCTTTGCTGG + Intergenic
1080522367 11:33078546-33078568 GTTGCTGCCACCAGCTTTGCTGG + Intronic
1080645873 11:34187029-34187051 CTGTCTCTTACCAGCTGTGATGG + Intronic
1084346303 11:68551849-68551871 CAGTCTGTTTACAGCTTTGCAGG + Intronic
1084995547 11:72974041-72974063 CTGTCTGTTATCAACTCTGCTGG - Intronic
1085722043 11:78921168-78921190 CTGGCTCTTCCCAGCTTTTCTGG - Intronic
1085997115 11:81931715-81931737 CAAGATGTTACCAACTTTGCAGG - Intergenic
1088979791 11:114851865-114851887 CTGGCTTTTTCCAGCTCTGCAGG + Intergenic
1091317746 11:134626371-134626393 CTGGCTGCCTCCAGCTTTCCAGG + Intergenic
1095783293 12:46084381-46084403 CTGGCTGGAGCCAGCATTGCAGG + Intergenic
1095854161 12:46842356-46842378 CTGGTTGTTACCAGATCTGTGGG - Intergenic
1096257350 12:50071576-50071598 CTGGCTGCTTTCAGCTTTGTGGG + Intronic
1099849678 12:88076203-88076225 CTTGCTGTCAGAAGCTTTGCTGG - Intronic
1104450380 12:128864105-128864127 CTGGCTGATGCCAGCTCGGCTGG + Intronic
1104625517 12:130350973-130350995 CTGGCTGTTTCCATCTTGCCAGG - Intronic
1105572826 13:21620231-21620253 CTGCCTCTTGCCAGCTCTGCAGG + Intergenic
1105878336 13:24580554-24580576 CTGGCTGTTGCCAGTGCTGCTGG + Intergenic
1105921517 13:24968519-24968541 CTGGCTGTTGCCAGTGCTGCTGG - Intergenic
1106798774 13:33234228-33234250 CTGACTGGTACCCGCTTTTCTGG + Intronic
1110828928 13:80007652-80007674 CTGGCAGTTTCCATCATTGCTGG - Intergenic
1113553392 13:111211178-111211200 GTTGCTGTTTCCTGCTTTGCAGG + Intronic
1113560152 13:111272366-111272388 CTGGCAGTAGCCAGCTTGGCTGG + Intronic
1113926958 13:113947001-113947023 CTGGCTGTGGCCAGCACTGCAGG + Intergenic
1117899454 14:60516722-60516744 CTGGCTGTTACCTACTTGTCGGG + Intergenic
1118652786 14:67915490-67915512 TTGGCTTTTATCATCTTTGCTGG + Intronic
1119540063 14:75432111-75432133 ATGGCTGTCCCCAGCTCTGCAGG - Intronic
1125237973 15:37538166-37538188 ATGGCTGTTACCAGGGTTACTGG + Intergenic
1125413374 15:39427972-39427994 CTGGCTATTGCTGGCTTTGCTGG - Intergenic
1128908014 15:71485553-71485575 TTTGATGTTACCAGCCTTGCTGG + Intronic
1129523645 15:76200895-76200917 CTGGCTCTTAAAAGCTTTTCTGG - Intronic
1129826971 15:78640769-78640791 CTGGATGACACCGGCTTTGCAGG - Intronic
1133271060 16:4610966-4610988 CTGGCTGTTACCACCTCAACGGG + Intronic
1134796481 16:17041753-17041775 CTGGCTCTTAGCAGCTGTGCAGG + Intergenic
1135044772 16:19146197-19146219 CTGGCTTCTAACAGCTTTGGGGG + Intronic
1138007971 16:53355238-53355260 CTGGATGGCACCGGCTTTGCAGG + Intergenic
1144864018 17:18323432-18323454 CTGGCTGTATTCAGCATTGCCGG + Intergenic
1144953272 17:19005073-19005095 CTGGCTGTGCCCAGTTTCGCCGG + Intronic
1145254652 17:21316015-21316037 CTGGCTCTTACCAGCTGGGAAGG + Intergenic
1145321945 17:21771950-21771972 CTGGCTCTTACCAGCTGGGAAGG - Intergenic
1148005000 17:44420466-44420488 GTAGATGTTACCAGCATTGCTGG + Intronic
1148110177 17:45139938-45139960 ATGGTGGGTACCAGCTTTGCAGG - Intronic
1149163307 17:53720757-53720779 CTCGCTGTTATCAGCTGGGCTGG - Intergenic
1151453252 17:74212164-74212186 ATGGCTGTTTCCAGCCTTCCGGG + Intergenic
1154999726 18:21674643-21674665 CTGGCTGAGACCAGCCTTCCTGG + Intronic
1156070613 18:33202496-33202518 TTGACTGGTAACAGCTTTGCTGG - Intronic
1158218360 18:55124064-55124086 CTGCTTGTTACCTGATTTGCAGG - Intergenic
1160623171 18:80184959-80184981 GTGGCTCCTTCCAGCTTTGCGGG + Intronic
1161659989 19:5539987-5540009 CTGGCTGTTGGCAGCTTTAATGG - Intergenic
1161754740 19:6123935-6123957 CTGAATGTTACCAACTTTTCAGG + Intronic
1162409579 19:10497373-10497395 CTGGCTGGTACCAGCTGGGATGG - Intronic
1162648136 19:12064941-12064963 CTGGCTGGAACCGGCTGTGCCGG + Intronic
1163169338 19:15519815-15519837 GTGGGTGTTACCATCTTGGCAGG - Intronic
1164806422 19:31120553-31120575 CTGGCTTTTACCAGTTATTCAGG + Intergenic
1165180565 19:33963913-33963935 CTGGCTGTTATCAGTTGTCCTGG - Intergenic
1165362671 19:35346376-35346398 CTGGCTCTGGCCAGCTCTGCCGG - Intronic
1168143081 19:54402569-54402591 CTGGCTGTTTCCAGTCTTGGGGG + Intergenic
1168586399 19:57597142-57597164 ATGTCTGTTACCAGCTATTCTGG + Intergenic
924969164 2:108676-108698 CTGGCTGCTACCACCTCAGCTGG - Intergenic
925072306 2:979458-979480 CGGGCTGTGCCCAGCCTTGCTGG + Intronic
925410255 2:3635648-3635670 CTGTGTGTTGCCAGCTGTGCAGG - Intronic
926433253 2:12812015-12812037 CTGGCTTGTACCAGCTTGGAAGG - Intergenic
927518283 2:23684753-23684775 TTTGCTGTCACCAGCTTTGCTGG + Intronic
928076043 2:28265544-28265566 CTGGGTATTGCCAGCTTTGGGGG + Intronic
929959624 2:46486767-46486789 CTGGCTGGTAACTGCTTAGCTGG - Intergenic
933363872 2:81324240-81324262 CTGGCTGTGGCCAACGTTGCTGG + Intergenic
934861214 2:97764855-97764877 CTGGCTGTCACCTGCTCTCCCGG + Intronic
935854137 2:107256775-107256797 CTGGCTGGTACCACCCATGCTGG + Intergenic
937440068 2:121907938-121907960 CTGGCTGGGACCAGCCTTCCTGG + Intergenic
942013661 2:171789682-171789704 GTGGCTCTGACCAGCTGTGCTGG + Intronic
944260167 2:197668131-197668153 CTGGCTGCTACCACCATAGCTGG - Intronic
945807214 2:214504503-214504525 CTGTGTGTAACCAGCTTCGCTGG - Intronic
946903793 2:224396837-224396859 CTGGCTGCTAGCAGCTCTGAGGG - Intronic
1169027361 20:2382206-2382228 CTGGCAGTTAACAGCATTGCTGG + Intronic
1169496648 20:6122488-6122510 CTGTCTTTTGCCAGCTCTGCAGG + Intronic
1171196685 20:23205423-23205445 CTGGCAGGCACCAGCTGTGCTGG - Intergenic
1171405956 20:24912721-24912743 CTGCGTGTTCCCAGGTTTGCTGG + Intergenic
1172025106 20:31943126-31943148 CAGCCTGGCACCAGCTTTGCTGG + Exonic
1172186856 20:33036372-33036394 CTGGCTGGTGCCAGCTTCTCTGG + Intronic
1175466468 20:59193506-59193528 CTGGTTGCTTCCAGCTGTGCAGG - Exonic
1176739663 21:10589355-10589377 CTGGCTGTTGCCAGTGCTGCTGG + Intronic
1177207180 21:18023407-18023429 CTGCCTGCTACCATCTCTGCAGG - Intronic
1178978851 21:37244165-37244187 CTTGCTCTTCTCAGCTTTGCTGG + Intronic
1179075073 21:38113396-38113418 CTGGCTGGGTCCAGCATTGCAGG - Intronic
1179886329 21:44315764-44315786 CTGGCTGGTGCCAGCGATGCGGG + Intronic
1180737959 22:18032673-18032695 CTGGCTGTTTCCAGGCATGCGGG - Intergenic
1181047812 22:20223888-20223910 CAGGCTCTGTCCAGCTTTGCTGG - Intergenic
1184233524 22:43171078-43171100 CTGCCTGTCGCCAGCCTTGCAGG - Intronic
1184370162 22:44076921-44076943 CTGTCTGATACCAGCTTGGCTGG + Intronic
1185061995 22:48611925-48611947 CTGGGTGTTGGCAGCTCTGCTGG + Intronic
950854728 3:16094412-16094434 CTGGCTGTCACTAGCTTGTCAGG + Intergenic
951421249 3:22488326-22488348 CTGGCTGCTTCCAGCTTTGGGGG - Intergenic
953240764 3:41147504-41147526 CTAGGTGTGACCAGCTTTGAGGG - Intergenic
954794163 3:53153092-53153114 CTGGCTATCCCCAGCTTTGAGGG - Intergenic
961026068 3:123558830-123558852 CTTGGTGTTCCCAACTTTGCAGG + Intronic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
962649852 3:137477508-137477530 CTGGCCTTTAGAAGCTTTGCAGG + Intergenic
963107227 3:141657711-141657733 CTGGCAGCTACCAGCTGTGGTGG + Intergenic
967751173 3:193118083-193118105 CTGGCTGGGGCCAGCATTGCAGG + Intergenic
968204008 3:196782427-196782449 CTGACCATTACCAGCTTTGTTGG + Intronic
970191878 4:13525180-13525202 ATGGCTCTTCCCAGCTTTCCCGG + Intergenic
981046182 4:140267401-140267423 CTGAGTGAGACCAGCTTTGCGGG + Intronic
981167056 4:141573059-141573081 CTGGCTGTTTTCAGTTTTTCTGG - Intergenic
983529379 4:168794010-168794032 CTGGCTGTCCCCAGCTTTCTAGG + Intronic
987113286 5:14707119-14707141 CCGGTTAGTACCAGCTTTGCAGG - Exonic
987288340 5:16483200-16483222 CTTGCTGATACCAGCTTTTATGG + Intronic
987942204 5:24553943-24553965 CTGGCTGCTACCAGAATTTCAGG + Intronic
988575135 5:32415165-32415187 TTGGCTGTAACCTGCTTTGGGGG + Exonic
991315713 5:65303128-65303150 CTCACTTTTACCAGGTTTGCAGG + Intronic
992411552 5:76510517-76510539 CTGGCTGCTGCCATCTGTGCTGG + Intronic
992877436 5:81070589-81070611 CTGGAGGTTTCCAGCTTTGTAGG + Intronic
994322428 5:98408613-98408635 CTGGCTGGTTTCAGCTTTCCTGG + Intergenic
996817676 5:127591769-127591791 CAGGCTTGTACCAGCTTTGCAGG - Intergenic
998060633 5:139116029-139116051 CTGGCTCTTTGCAGCTTTGGAGG - Intronic
998450419 5:142230184-142230206 ATGGCGGTTACCAGGTTTGAGGG + Intergenic
1001169848 5:169408829-169408851 TTGCATGTTCCCAGCTTTGCAGG - Intergenic
1007796049 6:44348571-44348593 CTGGATGTTACCAGGTCTGTGGG + Intronic
1008226186 6:48919881-48919903 CTGGCTGATACAAGCCTTGATGG + Intergenic
1008578993 6:52888695-52888717 CTTTCTGTTAGCAGCTTTTCAGG + Intronic
1013772176 6:113640306-113640328 CTGGCTGTTATCATGTTTGATGG + Intergenic
1014010349 6:116468447-116468469 CTGGCTCTTATCAGCACTGCTGG + Intergenic
1018957061 6:168417278-168417300 CTGGCTGTTGCTAGCTGCGCTGG + Intergenic
1021665020 7:22968618-22968640 CAGGCTGTCACCCCCTTTGCTGG + Intronic
1023612901 7:41989332-41989354 TTGGCTCTTACCATGTTTGCTGG - Intronic
1023613746 7:41997344-41997366 CTGGACTTTACCAACTTTGCAGG + Intronic
1026587881 7:71671600-71671622 TAGGCTGTTACCAGCTGTGTGGG + Intronic
1026976919 7:74504560-74504582 CTGTCTGTCTCCAGCCTTGCTGG - Intronic
1028738133 7:94241016-94241038 CTGGTTTTTACCAGTTTTCCAGG - Intergenic
1031068946 7:117140956-117140978 GTGGCTGTTCCCAGCCTTGCAGG + Intronic
1034039023 7:147856950-147856972 CTGGCTGTGACAAACTTTCCTGG - Intronic
1037598825 8:20376483-20376505 CTCGTTCTTAACAGCTTTGCTGG - Intergenic
1039773778 8:40715859-40715881 CTGGCTGTTGTCAGGGTTGCAGG - Intronic
1039839626 8:41284562-41284584 CTGGCTGTTGTCAGCCATGCTGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1046782739 8:118232803-118232825 CAGGGTGTTGCCAGCCTTGCAGG + Intronic
1048172197 8:132117816-132117838 CGGGCTGTTGCTAGCTTTGCAGG + Intergenic
1049538914 8:143197282-143197304 CTCGCTGTCAGCTGCTTTGCTGG - Intergenic
1050050869 9:1600134-1600156 TTGGTTGTTACAAGCTTTTCAGG + Intergenic
1053272079 9:36757101-36757123 GTGGCTGTTACCACGTTTCCAGG + Intergenic
1053504151 9:38627004-38627026 GTGCCTGTTACCAGCGCTGCTGG + Intergenic
1055020069 9:71660137-71660159 CTGTCTGTCTCCAGCTTTGAGGG - Intergenic
1055769402 9:79701336-79701358 CTAGCTGTTTCCGGTTTTGCAGG - Intronic
1057079257 9:92160001-92160023 CTGGATGGTCCCAGCTCTGCAGG + Intergenic
1057152224 9:92806590-92806612 GTGCCTGTTACCAGCGCTGCTGG - Intergenic
1061749731 9:132769460-132769482 CTGCCTGTTGCCAGCGTCGCAGG + Intronic
1186699791 X:12077996-12078018 CTGGCTGACACCAGCATTGCAGG - Intergenic
1186716089 X:12253249-12253271 CTCGCTGTTTCCAGCTGAGCTGG - Intronic
1187310262 X:18135007-18135029 CTGGCTGTTGAGAGCTTTGGGGG + Intergenic
1189872364 X:45397344-45397366 CTGGCTGTTCCCAGAATTGGTGG - Intergenic
1198096485 X:133384764-133384786 CTGGCTATTAAGAGATTTGCAGG - Intronic
1202597962 Y:26563207-26563229 CTGGCTGTTGCCAGTGCTGCTGG + Intergenic