ID: 905904437

View in Genome Browser
Species Human (GRCh38)
Location 1:41608467-41608489
Sequence TGCCTGCCTCTTTGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2137
Summary {0: 1, 1: 1, 2: 34, 3: 402, 4: 1699}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905904432_905904437 17 Left 905904432 1:41608427-41608449 CCTTAGAGAGCATTTGTTGGGGA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG 0: 1
1: 1
2: 34
3: 402
4: 1699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905904437 Original CRISPR TGCCTGCCTCTTTGTGAAGA AGG Intronic
Too many off-targets to display for this crispr