ID: 905905916

View in Genome Browser
Species Human (GRCh38)
Location 1:41618462-41618484
Sequence GCTGCCAGGAGCCACAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905905916_905905925 28 Left 905905916 1:41618462-41618484 CCATCCTTGTGGCTCCTGGCAGC 0: 1
1: 0
2: 1
3: 35
4: 331
Right 905905925 1:41618513-41618535 CAGCGTCTGCCTGCCATCCTCGG 0: 1
1: 0
2: 2
3: 29
4: 276
905905916_905905926 29 Left 905905916 1:41618462-41618484 CCATCCTTGTGGCTCCTGGCAGC 0: 1
1: 0
2: 1
3: 35
4: 331
Right 905905926 1:41618514-41618536 AGCGTCTGCCTGCCATCCTCGGG 0: 1
1: 0
2: 0
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905905916 Original CRISPR GCTGCCAGGAGCCACAAGGA TGG (reversed) Intronic
900489935 1:2942792-2942814 GCTTCCAGGGGCCAGCAGGAAGG + Intergenic
902331050 1:15731412-15731434 GCTGCAAGGAGCCCACAGGAGGG + Intronic
902889226 1:19429751-19429773 GCTGCCAGGAGTCTCTAGAAAGG + Intronic
903240701 1:21980940-21980962 GCTGCCCGGGGCCACAGGCAGGG - Intronic
903742370 1:25565716-25565738 GCTGCAGGGGGCCACAAGGATGG - Intronic
903867695 1:26410965-26410987 GCGGCCAGGAGCCACGTAGAAGG + Intronic
904209869 1:28879918-28879940 GCTGGAAGAAGCCACATGGAGGG + Intergenic
905061660 1:35145096-35145118 GCTGCCAGGAGCAAGGTGGAGGG + Intergenic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
905905916 1:41618462-41618484 GCTGCCAGGAGCCACAAGGATGG - Intronic
905931140 1:41788443-41788465 GCAGCCAGGAGCCCCAGGGAAGG + Intronic
906493409 1:46285795-46285817 GGTGCCAGGAGCCTCATGGGAGG + Exonic
906590312 1:47018895-47018917 GCAGCCAGGAGCCACTGGGATGG - Intergenic
908255419 1:62299506-62299528 GCAGACAGAAGCCTCAAGGAAGG + Intronic
909571938 1:77123616-77123638 GCTGCCAGGAGCTGGGAGGAGGG + Intronic
910648673 1:89540670-89540692 GAGCCCAGGAGCCCCAAGGAAGG + Intronic
911316764 1:96365237-96365259 GCTGCAAGGAGCCATAATGCAGG - Intergenic
912499370 1:110111916-110111938 GATCCCAGGAGGCACCAGGAGGG - Intergenic
912518703 1:110231201-110231223 GCTGACAGGAGCCAGAGGGGAGG + Intronic
912543488 1:110434335-110434357 GCTGCCAGGAGCGAAAAGAAAGG - Intergenic
913148684 1:116018174-116018196 GTTACCAGGCGCCAGAAGGAGGG - Intronic
915016839 1:152742363-152742385 GATGCCAGGAGCAAGGAGGAGGG - Intronic
915666294 1:157448244-157448266 GCAGCCAGTAGCCACTGGGATGG - Intergenic
917055039 1:170971763-170971785 GCTGCCAGGAGACCCAAACATGG - Exonic
917373346 1:174320252-174320274 GTTGCCAGGAACCACAAGTGAGG - Intronic
917436344 1:175024786-175024808 GTTGCCAGGAGCTGAAAGGAAGG - Intergenic
917563392 1:176183917-176183939 GCTGCCAGGGGATACAGGGAAGG + Intronic
918064331 1:181089317-181089339 GCTGCCTGGAGCCGCGTGGAGGG + Exonic
919782462 1:201229590-201229612 GTTTCCAGGAGCCAAAAGAAAGG + Intergenic
920857137 1:209672394-209672416 GCTGCCTGGAGCCCCAGGGGTGG + Intergenic
921049459 1:211500799-211500821 GGGGGCAGGAGCCACAGGGAAGG - Intergenic
922100094 1:222472489-222472511 GCTGCCAGGAGGCCCAAGCTGGG + Intergenic
922101114 1:222477534-222477556 GCTGTAAGGAGCCACACGGCAGG - Intergenic
922712982 1:227846786-227846808 GCTGAAAGTAGACACAAGGAAGG + Intergenic
1063515266 10:6688895-6688917 GTTGTCAGGAGCCACAAGAAGGG + Intergenic
1063930725 10:11026161-11026183 GCAGCCAAGAGGCACAAGGTAGG - Intronic
1063962843 10:11321365-11321387 GCTGCAGGCAGCCAGAAGGAAGG + Exonic
1064392890 10:14956785-14956807 ACAGGCAGGAGCCACCAGGATGG - Intergenic
1065207606 10:23372160-23372182 GTTGCCAGGGGCTACAGGGAGGG + Intergenic
1067242265 10:44506950-44506972 GCTTCCAGGAGCCACTGGGTAGG - Intergenic
1068536481 10:58245261-58245283 GCTGCCAGGGGCCAGGAGAAGGG + Intronic
1069511006 10:69042543-69042565 GCTGCCAGGAAGAACAAGGCAGG + Intergenic
1069749253 10:70735147-70735169 GCTGCCAGTAGAGACAAGGAAGG - Exonic
1070513957 10:77186459-77186481 GCTGAAAGGAGACACAAGCAAGG + Intronic
1070564568 10:77593919-77593941 GCTCCCAGGAGCCCAATGGATGG - Intronic
1070698239 10:78578992-78579014 ACTGGTAGGAGCCACGAGGATGG + Intergenic
1070737171 10:78871100-78871122 GGAGCCAGGAGGCAAAAGGATGG - Intergenic
1071892308 10:90023794-90023816 GCTTTCAGGAGCCAAAAAGAAGG - Intergenic
1071980791 10:91002887-91002909 GCTGCCAGCTGCCACATGGCAGG + Intergenic
1072712057 10:97722396-97722418 GCTGCCAAGAGTAGCAAGGATGG + Intergenic
1072744075 10:97927912-97927934 GCTACAAGGAGCCAGAAGGCAGG - Intronic
1073179978 10:101577788-101577810 GCTGCCAAGAGCCACAGTGGGGG - Intronic
1073586006 10:104710726-104710748 GCTCCTATGAGCCACAAGAATGG - Intronic
1074885036 10:117686606-117686628 GCTGCTGGGAGCCACAAAGATGG - Intergenic
1075106233 10:119542091-119542113 GCCGCGAGGAGCCAAAAGGTGGG - Intronic
1075562909 10:123481379-123481401 GCTGCCAGGAACTCCCAGGATGG + Intergenic
1076712951 10:132348850-132348872 GCTGCCTGGGGACAAAAGGAAGG + Intronic
1076834069 10:133012204-133012226 GCTGCCAGGAGCCAAAATCAGGG + Intergenic
1076982612 11:212887-212909 GCTGCCAGGGGCCTCATGGCAGG + Exonic
1077036915 11:499731-499753 CCTGCCAGGAGCCGTGAGGAGGG - Intronic
1078691198 11:13582463-13582485 GCAGCCAGCAGCTACAGGGATGG - Intergenic
1079954018 11:26840584-26840606 GTTACCAGGAGCCAGAAAGAGGG - Intergenic
1080520295 11:33062679-33062701 GCTGCCAGGGGCCAGAGGGCGGG - Intronic
1081283927 11:41245564-41245586 ACTGACAGGAGCCCCAAAGAAGG + Intronic
1081653628 11:44842139-44842161 GCTGGCAGAAGCCCCAAGGTGGG + Intronic
1081833323 11:46133352-46133374 ATTCCCATGAGCCACAAGGAAGG + Intergenic
1082014584 11:47475335-47475357 GCTGCTGGAAGCCAGAAGGAAGG - Exonic
1082725891 11:56736317-56736339 GCTGCAAGGAGCAACAGAGATGG - Intergenic
1083769557 11:64858876-64858898 GCTGCCAGGAGACCTAAGGATGG + Intronic
1083829118 11:65219832-65219854 GCTGCCATGTGACACCAGGACGG + Intergenic
1084182677 11:67454580-67454602 GCTGCCGGGTGCCACAAAGCAGG - Intronic
1085804279 11:79620229-79620251 GCTGCTTGGAGCCACAAGTTGGG + Intergenic
1087744136 11:101923686-101923708 GATGCCAGGAGCCCAAAGGTAGG - Intronic
1089149147 11:116351338-116351360 GCCCCCAGGGACCACAAGGATGG + Intergenic
1089257248 11:117200428-117200450 CCTGGCAGGAGCCACAGGGCAGG + Intronic
1090495249 11:127205620-127205642 GCTGCCAGGCACCACAAGTGTGG - Intergenic
1091057249 11:132430510-132430532 GCTCCCAGGAGCCGCGAGGCAGG + Intronic
1091063346 11:132485540-132485562 GGTGGCAGGAGCCACATGGTGGG - Intronic
1091157237 11:133385020-133385042 CCTGCCCACAGCCACAAGGAGGG - Intronic
1092325542 12:7527643-7527665 GCTGACTGGAGCCACAATGGTGG + Intergenic
1093556252 12:20477950-20477972 TCTGCCAGAAGCCACAAGTTTGG + Intronic
1096796181 12:54079393-54079415 GCCACCAGGAGACAGAAGGAAGG - Intergenic
1098569385 12:71971546-71971568 GCAGCCAGCAGCCACAGGCAAGG - Intronic
1099215006 12:79842958-79842980 GCTGCCAGGGGCTGGAAGGAGGG - Intronic
1100633993 12:96417291-96417313 GCTGCCATGAGCCAGAATCAAGG + Intergenic
1102527242 12:113520649-113520671 AGTGCCAGGAGCCTCCAGGAGGG - Intergenic
1102887290 12:116531813-116531835 GCTGCCAGGGGCCAACGGGAGGG + Intergenic
1106138402 13:26991400-26991422 GGTGCCAGGAGACCCCAGGATGG - Intergenic
1107126890 13:36856039-36856061 GGTGCCAGGGGGCAGAAGGATGG + Intronic
1107844069 13:44492914-44492936 GATGCCAAGAGCTACAAGGGAGG - Intronic
1109968742 13:69737512-69737534 GCTGACTGGAGCCACAGTGATGG - Intronic
1110482599 13:75997762-75997784 GTTGCCAGGAGCTAGAGGGAGGG - Intergenic
1110847218 13:80203605-80203627 GATGCCAGGAGACACGAGGAAGG - Intergenic
1113568017 13:111330736-111330758 GCTGCCAGGGGCCAGAGAGAGGG - Intronic
1116632150 14:47349886-47349908 ACTGGCTGGAGCCACATGGAAGG - Intronic
1116920481 14:50567132-50567154 GCTGCTAGTAGCCATGAGGAGGG - Intronic
1117224332 14:53639163-53639185 GCTGCCAGTAGCCACTGGCAGGG + Intergenic
1118004137 14:61550103-61550125 GTTAACAGGAGCCAAAAGGAGGG + Exonic
1118414109 14:65514320-65514342 GCTGGCAGGACCCTCAAGGCAGG + Intronic
1118789469 14:69076608-69076630 GTTGCCAGGAGCTAAGAGGAGGG + Intronic
1119428191 14:74549683-74549705 GCTGCCAGGAGCCTCAGTGCTGG + Intronic
1120492660 14:85196229-85196251 GCTGCCAGGAGTATCAAGAATGG + Intergenic
1120737877 14:88075685-88075707 GTTGCCAGGGGCTACAGGGAGGG + Intergenic
1121583746 14:95048916-95048938 GGGGCCAGGAGCCACAAGTGTGG - Intergenic
1121693189 14:95892462-95892484 GCTGCCAGGAGCCCTGAGGAAGG - Intergenic
1121838218 14:97110672-97110694 GCTGCCAGGGGCCACCAGAACGG - Intergenic
1122116874 14:99532136-99532158 GGGGCCAGGATCCACAAGGGTGG + Intronic
1122229400 14:100298141-100298163 GCTGCCAGCAAGCACAAGGCTGG + Intronic
1122389007 14:101367742-101367764 GCTGCTGGGAGCCAGGAGGATGG + Intergenic
1124050101 15:26189300-26189322 GCTTCCAAGAGCCAAAAGGTAGG - Intergenic
1125584841 15:40813007-40813029 CCAGCCCAGAGCCACAAGGAAGG + Intronic
1125917118 15:43497707-43497729 GCTGCCAGGAGCTAGGAGGAGGG + Intronic
1127292997 15:57586769-57586791 GCTCCCAGGAGAAACCAGGAAGG - Intergenic
1127488660 15:59441680-59441702 GCTGCCAGGAGACGCAGGGCAGG - Intronic
1128356778 15:66933670-66933692 GTTGCCAGGAGCTGGAAGGAGGG - Intergenic
1128814607 15:70598610-70598632 GCTGCTAGGACCCGCAAGGTTGG + Intergenic
1129567033 15:76633793-76633815 GCTGACTGGAGCCACAGTGATGG + Intronic
1129884742 15:79030303-79030325 GCTGCCAAGGGCTACAAAGAAGG - Intronic
1131796663 15:96024625-96024647 GCTCCCAGGATCCAAAAGGGTGG - Intergenic
1132050526 15:98604458-98604480 GATGGAAGGTGCCACAAGGATGG - Intergenic
1132150154 15:99453299-99453321 GCTCCCAGCAGCCGCAGGGAGGG - Intergenic
1132699943 16:1218054-1218076 GCTGCCAGGTGCCAGAGGCATGG - Intronic
1132723274 16:1327355-1327377 GCTGGCTGGAGCCACCAGGTAGG + Intergenic
1132975714 16:2710181-2710203 GCTTCCTGGAGCCACAGGGCTGG - Intergenic
1133207527 16:4242249-4242271 GCTGCCAGGCCCCAGAAGGCAGG + Intergenic
1133222175 16:4323485-4323507 GGGGCCCGGAGCCACCAGGATGG + Intronic
1133556568 16:6911408-6911430 GTTGCCAGCAACCACAGGGAGGG - Intronic
1134462496 16:14441627-14441649 GTTGCCAGGAGGAACAGGGAGGG + Intronic
1136016803 16:27405837-27405859 GGGGGCAGGGGCCACAAGGAGGG + Intronic
1136189409 16:28606717-28606739 GCCCCCAGGAGTCACATGGAGGG + Intronic
1136998025 16:35204146-35204168 GCTTCCAGGGGCCAAAGGGAAGG + Intergenic
1138421351 16:56901286-56901308 GCTATCTGAAGCCACAAGGATGG - Intronic
1139671261 16:68493533-68493555 GCTGGCAAGAGCCCCAAGGGAGG - Intergenic
1140961628 16:79918279-79918301 CCTGCCATGAGCCACAAGTTGGG + Intergenic
1141171087 16:81692121-81692143 CCTGCCAGGAGCCATGGGGAGGG - Intronic
1141771973 16:86094898-86094920 GCTCCCAGCAGCCAGAGGGAAGG - Intergenic
1142359521 16:89619639-89619661 GCTGCAGGGAGCTACAGGGAGGG - Intronic
1142596069 17:1030671-1030693 GATGCCAGGAGCCTCAATGCCGG + Intronic
1143096164 17:4479607-4479629 GCTGCCAGGAGGCAGAAGGAAGG - Intronic
1143631175 17:8141170-8141192 GCTGCGAGGAGGCCCAAGGCGGG - Exonic
1146629343 17:34458717-34458739 TCTGCTTGGAGCCACAGGGAAGG - Intergenic
1147345078 17:39786036-39786058 GCTGCCAGGAGCTAGAGGAAGGG + Intronic
1148764368 17:50028656-50028678 GGGGCCAGGAGGCACATGGAGGG - Intergenic
1149208838 17:54280475-54280497 GCTTCCAGAACCCACAGGGAGGG + Intergenic
1149270414 17:54970730-54970752 GCTACCTGGAGCTACAAAGAAGG - Intronic
1149768733 17:59302648-59302670 GTTGCCAGGGGCTGCAAGGAGGG + Intergenic
1149785876 17:59434471-59434493 CCTGCCAGGTGTTACAAGGAGGG + Intergenic
1150706095 17:67488736-67488758 GCTGCCAGGGGCTGCCAGGAGGG - Intronic
1151062587 17:71113305-71113327 CCTGCTAGGATCCAGAAGGAAGG - Intergenic
1151649482 17:75457218-75457240 GCTGCCAGGAGCCCCTCGGCCGG - Intronic
1151786399 17:76277132-76277154 CCTGCCTGGAGCCACCAGGGAGG - Intronic
1152862862 17:82705852-82705874 GCCGGCGGGAGCCACCAGGACGG - Intergenic
1157520558 18:48342409-48342431 GCTGCCAGGAGGGACAGGGCTGG + Intronic
1157582380 18:48781165-48781187 GGAGCCAGGAGGCACTAGGAGGG - Intronic
1157744527 18:50123265-50123287 GCTACCAGGGGCCAACAGGAGGG + Intronic
1160551619 18:79697151-79697173 GCTGGCAGGTGCCAGAAAGATGG - Intronic
1160622807 18:80182321-80182343 GCCCCCAGTATCCACAAGGAGGG + Intronic
1160934689 19:1588385-1588407 GCTTCATGTAGCCACAAGGAAGG + Intronic
1161520286 19:4720019-4720041 GCTGCCTGGAGCAATGAGGAGGG - Intronic
1162662440 19:12181094-12181116 GGAGCCAGGAGCCAGAAGAAAGG - Intronic
1163124328 19:15236603-15236625 TCAGCCAGGGTCCACAAGGATGG + Exonic
1164565882 19:29325643-29325665 GGTGCCAGGCCCCACATGGAAGG - Intergenic
1165124191 19:33582344-33582366 GCAGCCAGGAGCCCCAAGAAGGG + Intergenic
1166210682 19:41304856-41304878 GCTGCCAGGAGACCAATGGATGG + Intronic
1166227031 19:41402569-41402591 GCTGCCAGGAGGAGAAAGGATGG + Intronic
1166568494 19:43779403-43779425 GTGACCAGGAGCCACATGGAGGG - Intronic
1167241647 19:48347237-48347259 GCTCCCAAGAGACACATGGAGGG - Intronic
1167498007 19:49830562-49830584 GCTGCCAAGAACCAGAAGGCTGG + Exonic
1167501529 19:49851279-49851301 GCTGCCGCGGGCCACAAGGGGGG - Exonic
1167634047 19:50643340-50643362 GATGCAAGAAGGCACAAGGACGG - Intronic
927103199 2:19803564-19803586 ACTGCCTGGAGGTACAAGGAAGG + Intergenic
927965527 2:27265234-27265256 CCTGCCGGGAGCCACCAGGCGGG + Intronic
928582449 2:32722910-32722932 GCTGCCAAGAGCGACACTGATGG + Intronic
931764594 2:65443705-65443727 GATGCCAGGAGCTACCAGGAGGG + Intergenic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
935287282 2:101576334-101576356 GCTGCCACGCGGTACAAGGAAGG + Intergenic
935428110 2:102942630-102942652 CCTGCCAGGAGACAGAAGGGCGG + Intergenic
936241313 2:110790807-110790829 GCTGGGAGGAGCCAGGAGGAGGG - Intronic
937545581 2:123014618-123014640 GTTGCCAGGGGCTTCAAGGAGGG + Intergenic
940031021 2:149261396-149261418 GCTGCCAGGATTCACCAGAAAGG - Intergenic
940268829 2:151869520-151869542 GCTGCCAGGAGACAACAGGCTGG + Intronic
941911863 2:170771341-170771363 GCTGCCAGGGGCCGCCGGGAAGG + Intergenic
943542246 2:189231155-189231177 GTTGCCAGGAGCTAGGAGGATGG + Intergenic
943609981 2:190020755-190020777 GCTGCCAGGGGCTGGAAGGAGGG - Intronic
944723032 2:202442603-202442625 GTTGCCAGGAGCTAGAGGGAGGG - Intronic
945385371 2:209192643-209192665 GCTTGCAGGATCCAGAAGGAAGG - Intergenic
945714133 2:213336740-213336762 CCTGAGAGGAGCCACTAGGAGGG + Intronic
946396787 2:219447479-219447501 GCTTCCAGGGACCACTAGGAAGG + Intronic
946832836 2:223743298-223743320 CCTGCCAGAAGCCACACGGCTGG + Intergenic
948258053 2:236582980-236583002 TCTACCTGGAGCCACAAGAATGG + Intergenic
948623377 2:239250784-239250806 GCTGCCAGAGGCCACAGCGAAGG + Intronic
1168889839 20:1287898-1287920 TCTGCCAGGAGCCACTAGCCAGG + Intronic
1172941852 20:38659519-38659541 GCTGGCAGGAGGCCCAGGGAGGG + Intergenic
1173249692 20:41357992-41358014 GCTGCTGGGAGACAGAAGGATGG - Exonic
1174105680 20:48160917-48160939 GCAGGCAGGAGCCATGAGGATGG - Intergenic
1174421283 20:50400648-50400670 GCTGTCAGGAGCCAGGGGGAAGG + Intergenic
1174443893 20:50577581-50577603 GCCGCCAGAAGCCTCAAGGAAGG + Intronic
1175117063 20:56690064-56690086 GCTCCCAGCAGCCACAGGAATGG + Intergenic
1175204472 20:57301292-57301314 GGTGCCACGGGCCCCAAGGAGGG - Intergenic
1175430508 20:58898963-58898985 GCTGCAAGGAGCAACAGCGATGG + Exonic
1175981038 20:62738764-62738786 GCTGCCAAGAGCAGCAAGGCTGG - Intronic
1176170710 20:63695230-63695252 GCTGCCAGGAGCAGCCAGGCAGG - Intronic
1179475158 21:41638445-41638467 GCTAACAGCAGCCACATGGAGGG - Intergenic
1179879918 21:44289209-44289231 GCAGCTGGGAGACACAAGGAAGG - Intronic
1179910228 21:44443589-44443611 GCCTCCAGGTGCCACAGGGAAGG + Intergenic
1180205667 21:46258120-46258142 TGTGCCAAGAGCCACAAGAAAGG + Intronic
1180612373 22:17106364-17106386 GCTGCCCTGAGCCACAGGGGTGG + Intronic
1180636896 22:17268981-17269003 GCTCCCTGGAGCCACATGGAAGG - Intergenic
1180898380 22:19353700-19353722 GGTGCCAGGAGGCACATGGCTGG - Intronic
1180916119 22:19488561-19488583 GCATCCAGTAGCCACAAGGGAGG + Intronic
1182428404 22:30286704-30286726 GCTGCCAGGAACCCCAAGAGAGG + Intronic
1183162325 22:36123279-36123301 ACTGCCCAGAGCCAGAAGGATGG + Intergenic
1183346602 22:37311644-37311666 GCAGCCCTGAGCCACAGGGAAGG - Intronic
1183962718 22:41421723-41421745 GTTGCCTGGGGACACAAGGATGG - Intergenic
1184217241 22:43075962-43075984 TGTGCCAGGAGCCACAAAGGAGG + Intronic
1184311043 22:43643067-43643089 CCTGTCTGGAGCCAGAAGGAGGG - Intronic
1184429629 22:44434293-44434315 GCTGTCAGGGGCCAAAAGCATGG - Intergenic
1185343598 22:50302071-50302093 GCTGCCTGGAGCCCCGAGGGAGG + Intronic
1185360249 22:50402406-50402428 GGCCCCAGGAGCCATAAGGAAGG + Intronic
950272141 3:11625876-11625898 GCTGCCAGGGACCAGCAGGACGG + Intronic
952337548 3:32417237-32417259 GTTGCCAGGAGTTACAAGGTGGG - Intronic
954131669 3:48564210-48564232 GGTGGCAGGAGCCACAATGGGGG + Exonic
954321433 3:49834401-49834423 GCAGCCAGAACCCACAAGGAGGG + Intronic
954379198 3:50210735-50210757 GGGGCCAGGAGCCACAGGGATGG - Intronic
954792816 3:53145503-53145525 CCTGCCAGGAGCCAGGAGGTAGG + Intergenic
955803067 3:62706001-62706023 GAAGCCAGGAGCCACAAAGCAGG - Intronic
958748135 3:98162541-98162563 GCTGCCAGAAGCCAGAAGCCAGG - Intergenic
958987100 3:100793969-100793991 GTTGCCTGGAGAAACAAGGATGG - Intronic
959090088 3:101893161-101893183 GCTGCCAGGAGCTAGGGGGAGGG - Intergenic
960254992 3:115502309-115502331 GCTTTCAGGAACCACAGGGAAGG - Intergenic
960750208 3:120941433-120941455 GGTGACAGTAGTCACAAGGATGG + Intronic
961734601 3:128993641-128993663 GCTCCCGGGAGCCACCAGGCGGG + Intronic
962348926 3:134642726-134642748 GATGCCATGAGCCAGAGGGAGGG + Intronic
962932567 3:140051544-140051566 GCTGCAAGGGGCCAGGAGGAGGG + Intronic
962975490 3:140442440-140442462 TCAGCCAGGAGGCAGAAGGAAGG - Intronic
963505643 3:146181415-146181437 GATGCCAGGAGCCTCTAAGAGGG + Intergenic
964528457 3:157641503-157641525 GCAGGCAGCAGGCACAAGGAAGG + Intronic
966720679 3:183059881-183059903 ACTGAAAGAAGCCACAAGGAAGG - Intronic
966912275 3:184566219-184566241 CCTGCCAGCAGCCAGAAGGACGG - Intronic
969609954 4:8221772-8221794 TTTGCCAGGAGCCACAATGATGG + Intronic
969921854 4:10547650-10547672 GCTGCCAGGAGCAAGGAGGAGGG - Intronic
970431956 4:15997067-15997089 TCTGCTATGAGCCACAGGGAAGG - Intronic
973011061 4:45073949-45073971 GTTGCCAGGAGCTGAAAGGAGGG - Intergenic
973142139 4:46781993-46782015 GCGACCAGGTGCCACAAGCAGGG - Intronic
974080722 4:57209610-57209632 CCTGCCAGAAACAACAAGGATGG + Intergenic
975846689 4:78532616-78532638 GTTACCAGGAGCGACGAGGAGGG - Intronic
980701828 4:136442121-136442143 GCTGCCAGGAGGCATGGGGAGGG + Intergenic
984916307 4:184727965-184727987 GCTGCCAGGGGCTTGAAGGAAGG + Intronic
985472612 5:54895-54917 GTTGCCAGGGGCCCCAGGGAAGG + Intergenic
986667241 5:10114365-10114387 GCTCCCAGGAGACACCAAGAGGG - Intergenic
988110465 5:26813001-26813023 GCTGACTGGAGCCACAGTGATGG - Intergenic
989150013 5:38290114-38290136 GGTGCCAGGAAGCCCAAGGAAGG + Intronic
989635775 5:43531234-43531256 TCTGCCAGGAGCCACAGAGTAGG - Intronic
992322539 5:75628202-75628224 GTTGCCAGGAGCTAGGAGGAAGG + Intronic
996746887 5:126853642-126853664 GCTGGCGGGGGCCACTAGGAGGG - Intergenic
996870803 5:128191099-128191121 GAGGACAGCAGCCACAAGGAAGG - Intergenic
996920518 5:128762589-128762611 GCTGCCAGCAGTGACAATGATGG + Intronic
998043559 5:138968759-138968781 GCTGCCTGCAGACACAAGGCTGG + Intronic
998905904 5:146904755-146904777 GGTGCCAGGAGTCAAAATGAGGG + Intronic
999077944 5:148815014-148815036 GCATCCAGGAGACACAGGGAAGG - Intergenic
1000625964 5:163538841-163538863 GCTGCCAGAGGCTAGAAGGAAGG - Intergenic
1001369960 5:171189546-171189568 GATTCCAGGAGCCACAATGACGG - Intronic
1001541540 5:172543076-172543098 GCTGCCAGCAGCTGCAAGGTAGG + Intergenic
1001762507 5:174220079-174220101 TCAGCCAGGAACCACCAGGATGG + Intronic
1002073602 5:176695315-176695337 GCAGCCATGAGCCAGAAGGGAGG + Intergenic
1002203555 5:177546879-177546901 GGTGCAATGAGCCACAAGGAGGG + Intronic
1002653530 5:180723216-180723238 GCTGCAAGAAGCCACCAGGATGG + Intergenic
1002799137 6:504391-504413 GCCGCCAGGAGCCACAACTGAGG - Intronic
1004637988 6:17487149-17487171 GCTTCCAGCAGGCACGAGGATGG - Intronic
1005231094 6:23702734-23702756 GCTGGCAGGAGCCTAAAGGTAGG - Intergenic
1005453330 6:25994861-25994883 GCTGCCTGGGGCCAAGAGGATGG - Intergenic
1005678987 6:28186041-28186063 GATTCCAGGAAGCACAAGGAGGG + Intergenic
1006432439 6:34005935-34005957 TCTGGCAGGGGCCACAAGGAGGG - Intergenic
1007282446 6:40722543-40722565 GCTGCCAGGAGACCCTTGGAAGG + Intergenic
1011413743 6:87094680-87094702 GCTTCCAGGAGCCAGACAGAGGG - Intronic
1011418561 6:87148822-87148844 GCTGGATGGAGCCAGAAGGAAGG + Intergenic
1016011974 6:139146666-139146688 GCTGCCAGAAGCCATGAAGAGGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1018945187 6:168342959-168342981 GGAGCGAGGAGCCAGAAGGACGG + Intergenic
1019408582 7:896953-896975 GCTGGCAGCAGGCACAGGGACGG - Intergenic
1019670626 7:2276236-2276258 GCTGCCAGGCCCCAGAAGGAAGG + Intronic
1019786702 7:2981721-2981743 GCTTCCTGGAGACCCAAGGAGGG - Intronic
1021336221 7:19405805-19405827 GTTGCCAGGAGCTAGAAAGAGGG - Intergenic
1021558873 7:21948820-21948842 CCAGCCAGGACCCAAAAGGATGG + Intergenic
1023285125 7:38611290-38611312 GCTGCCAGGAGATGCAAGGGGGG + Intronic
1023344080 7:39253190-39253212 GCTCCCAGGAGCTACATGGAAGG + Intronic
1023835870 7:44066780-44066802 GCTGCCAGGACCCCCAAGGCTGG + Intronic
1024240020 7:47427594-47427616 GCTGCCCAGGGCCAGAAGGATGG + Intronic
1025182893 7:56832623-56832645 GCTGCCAGGAGTCAGAAGATGGG + Intergenic
1025188248 7:56877414-56877436 GCTGCAAGAAGCCACACTGAAGG - Intergenic
1025249548 7:57342823-57342845 GCTGTCAGGAGCCAGGATGAAGG - Intergenic
1025683678 7:63699506-63699528 GCTGCAAGAAGCCACACTGAAGG + Intergenic
1025689033 7:63744351-63744373 GCTGCCAGGAGTCAGAAGATGGG - Intergenic
1025970743 7:66322413-66322435 ACTGCCAGGAGCAGCAAGGAGGG - Intronic
1026888428 7:73968055-73968077 GCAGACATGAGCCACAAGGCAGG - Intergenic
1029135074 7:98364473-98364495 GCTGCCACAGGCCACCAGGAGGG - Intronic
1029885375 7:103864453-103864475 GTTGCCAGGTGCCAGGAGGAGGG - Intronic
1032488399 7:132305623-132305645 GCTGCCAGGAGCTCCCCGGATGG - Intronic
1033756051 7:144398974-144398996 AGTGACAGCAGCCACAAGGACGG - Exonic
1034240039 7:149603387-149603409 ACTGCCAGCAGCCACTAGAATGG - Intergenic
1034415678 7:150963206-150963228 GCAGCCAGGACAGACAAGGAGGG + Intronic
1034531318 7:151697838-151697860 GCTGCCAGGATAAAGAAGGACGG + Intronic
1035350478 7:158242097-158242119 GCTGCTAGGAGCCACTAGCATGG - Intronic
1035673101 8:1435060-1435082 GCTTCCAGGAGCAATAAGGACGG - Intergenic
1036135641 8:6158733-6158755 GCTGGGAGGAGGCACAGGGATGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036812925 8:11880044-11880066 GGTGCTAGGAGCCACTGGGATGG + Intergenic
1036831236 8:12021674-12021696 GCTGGCATGAGGCACAGGGAGGG - Intergenic
1037106473 8:15114027-15114049 TCTGGCAGGAGACAAAAGGAGGG - Intronic
1037623742 8:20589885-20589907 GCTGAGAGGAGCCACAGGGCTGG - Intergenic
1037637238 8:20711044-20711066 GCTGCAAGAAGCCACCAGGCAGG + Intergenic
1037749059 8:21668155-21668177 GCTGCCAGGAGGACCCAGGAGGG - Intergenic
1039946185 8:42130732-42130754 GCTGCCAGGAGCTAGGAGGAGGG - Intergenic
1041311245 8:56519027-56519049 GGTGCCAGGAGCCACAGGGCAGG + Intergenic
1041774847 8:61512451-61512473 GCTGCCAGCAGCCAGAAGCTAGG + Intronic
1041854710 8:62438425-62438447 GCCCCCAGGAGCCACAGAGAGGG - Intronic
1043270710 8:78329732-78329754 GGTCCCAGGGACCACAAGGAGGG - Intergenic
1044531859 8:93316452-93316474 ACTGACAGCAGCCATAAGGAAGG + Intergenic
1045488786 8:102654644-102654666 GCTGCCGGAAGCCACGGGGAGGG - Intronic
1047928672 8:129704789-129704811 GCTGGCAAGAGCCACAGGAAAGG - Intergenic
1048084981 8:131167578-131167600 GCTGCTTGGACCCACAAGGGAGG + Intergenic
1048933105 8:139332122-139332144 GCTTCCAGGAGCTAGAAGGCAGG + Intergenic
1049250627 8:141586988-141587010 GTTGCCAGGCACCACAGGGAGGG + Intergenic
1049362691 8:142219791-142219813 GAGGCCGGGAGCCAGAAGGACGG - Intronic
1050618364 9:7426697-7426719 GCTGGCATGATCCACAAAGAAGG - Intergenic
1050977878 9:11965177-11965199 GTGGCCAGGGGACACAAGGAAGG - Intergenic
1051734691 9:20186434-20186456 TCTTCCTGGAGCCACATGGATGG + Intergenic
1051762911 9:20488186-20488208 GTTGCCAGGGGTCAGAAGGAGGG + Intronic
1052184128 9:25569514-25569536 GTTGCCAGTAGTCACTAGGAAGG + Intergenic
1052318675 9:27143843-27143865 CCTGCCAGATGCCACATGGAAGG - Intronic
1053221687 9:36318014-36318036 GTGGCCAGGAGCCAACAGGAAGG + Intergenic
1053283778 9:36837914-36837936 ACAGCCTGGAACCACAAGGAGGG + Exonic
1055050995 9:71980811-71980833 GCTGCCAGCTGACACAAGGCAGG + Intronic
1055631862 9:78232907-78232929 ACTGTGAGTAGCCACAAGGAAGG + Intergenic
1056654165 9:88495609-88495631 CCTGCCTGGAGACTCAAGGAAGG + Intergenic
1057433862 9:95021425-95021447 GATGCCAGGATCCTCAAGGCAGG - Intronic
1057501609 9:95601060-95601082 GCTGCCAGCAGCACCAAGGCTGG + Intergenic
1057698972 9:97349275-97349297 GCCACCAGGAGCCAAAAGTAAGG + Exonic
1059230582 9:112717898-112717920 GCTGCCTGTAGCAACAAAGACGG + Intronic
1060180330 9:121529315-121529337 GCTGCCACCAGCCTCAAGAAAGG + Intergenic
1060473539 9:123968519-123968541 GTTGCCAGGAGCTAGAGGGAGGG - Intergenic
1060621625 9:125072696-125072718 GCTGCCAGGGGCTAGGAGGAGGG - Intronic
1060766207 9:126296465-126296487 GCTGCCAGGAGCTGGAAGTATGG + Intergenic
1061419183 9:130464069-130464091 GCTGTCAGGAGCCACAGGATGGG - Intronic
1061607664 9:131723435-131723457 GCTGCCAGGGGCTGGAAGGAGGG - Intronic
1061715433 9:132515665-132515687 GGTGCCAGGAGAGGCAAGGAGGG - Intronic
1062250117 9:135589596-135589618 GCTGCCAGGAGCCTTTGGGACGG - Intergenic
1062389540 9:136328387-136328409 GGTGCCTGGAGCCCCAAGCAAGG + Intronic
1062519703 9:136952551-136952573 GCTTCCAGGAGCCCCCAGGCGGG + Intronic
1062613059 9:137383570-137383592 GCGGCCACGGGCCACAGGGAAGG - Intronic
1186525207 X:10241961-10241983 GCTGCCAGGTGCCAGAGGAAGGG + Intergenic
1186880623 X:13862521-13862543 GATGACAGGAGCAACAAGGTGGG + Intronic
1187485880 X:19702989-19703011 CCAGCCAGGAGCCAGAAGCATGG + Intronic
1187612983 X:20962026-20962048 GCTGCCTGGAGCTGGAAGGAGGG - Intergenic
1187920148 X:24193973-24193995 GCTGCCAGGGGCTGAAAGGAGGG - Intronic
1189287180 X:39860148-39860170 GCTGCCAGGAGCCTCAAAACAGG - Intergenic
1189364168 X:40375435-40375457 ACTCCCAGGACCCACTAGGATGG + Intergenic
1189999181 X:46668730-46668752 GCTGCCAGGGGCTGCAGGGAAGG + Intronic
1190534935 X:51416998-51417020 CCAGCCAGGAGACAAAAGGAAGG - Intergenic
1190960375 X:55240946-55240968 GCTGACTGGAGCCACAGTGATGG - Intronic
1194274432 X:91861560-91861582 GCTGTTTGGAGCCACAGGGATGG + Intronic
1195812629 X:108851342-108851364 GCTGCAGGGAGCCACAGTGATGG - Intergenic
1196013443 X:110912730-110912752 GTTGCCAGGGGCTAGAAGGAGGG + Intergenic
1198112748 X:133516094-133516116 GCTGCCAGCCGCCACACGTATGG - Intergenic
1199086163 X:143633474-143633496 GCTCCCAGCAGCCACAGAGAAGG - Intronic
1200038666 X:153349993-153350015 GCTCCCAGGAGCTCAAAGGATGG - Exonic
1200048604 X:153416227-153416249 GCTGCCAGGATGCAGTAGGAAGG - Intergenic
1200591666 Y:5082966-5082988 GCTGTTTGGAGCCACAGGGATGG + Intronic