ID: 905907925

View in Genome Browser
Species Human (GRCh38)
Location 1:41631993-41632015
Sequence CTGAACCTCCTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905907925_905907928 -4 Left 905907925 1:41631993-41632015 CCATCTTCCCTCAGGAGGTTCAG 0: 1
1: 0
2: 1
3: 18
4: 272
Right 905907928 1:41632012-41632034 TCAGCTAGCTCCCATAAAACTGG 0: 1
1: 0
2: 2
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905907925 Original CRISPR CTGAACCTCCTGAGGGAAGA TGG (reversed) Intronic
901078695 1:6571499-6571521 CGGAACCTCTGGAGGGAGGAGGG - Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
902258468 1:15206323-15206345 CTGAAACACCTCTGGGAAGAAGG + Intronic
902954292 1:19914377-19914399 CTGAACCTCCCTATGGTAGAAGG + Intergenic
903691700 1:25178634-25178656 CTGAACATCCTGAGAGCAGGTGG - Intergenic
904702100 1:32363787-32363809 CTCAACCATCTGACGGAAGAGGG - Exonic
905235336 1:36542521-36542543 CACAACCCCCTGAGGGCAGATGG - Intergenic
905620298 1:39439487-39439509 TTGAAGCTGCTGAGGTAAGAAGG + Exonic
905627004 1:39495742-39495764 CGGCCCCTCCTGAGGGAGGAAGG + Intronic
905669932 1:39785029-39785051 CGGCCCCTCCTGAGGGAGGAAGG - Intronic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
906250272 1:44305735-44305757 GTGAAGCTGCTGAGGGGAGAAGG + Intronic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
907157129 1:52344879-52344901 CTGAAACTTCTGAAGGAAGATGG + Exonic
907182339 1:52581858-52581880 TTCAAGCTCTTGAGGGAAGATGG - Intergenic
908152476 1:61316537-61316559 CTGAGCATCCTGAGGGGACAGGG + Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
909169307 1:72274411-72274433 CTGAACCTCAAGAGGACAGATGG + Intronic
910656887 1:89628855-89628877 ATGACCCACCTCAGGGAAGAAGG + Intergenic
911202637 1:95061119-95061141 CAGAACCTCCGGAGGGAGTATGG + Intronic
912450637 1:109765527-109765549 TGGAGCCCCCTGAGGGAAGAGGG + Intronic
912474925 1:109929129-109929151 GTGCAGCCCCTGAGGGAAGAGGG - Exonic
913570002 1:120110379-120110401 CTAAATCTGCTGAGGGGAGAGGG - Intergenic
915563391 1:156700594-156700616 CAGAAGCTCCTGAAGGGAGAGGG - Exonic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
919848331 1:201655565-201655587 CTGGGCCTCCTGAAGGAAGCAGG + Intronic
920227469 1:204449031-204449053 CTGAAGCAACTGAGGGAATATGG - Intronic
920451194 1:206062420-206062442 CTGCCCCTCCTGAGGCAAAAGGG + Intronic
921840269 1:219820825-219820847 CTAAAACTCTTGAGGGATGAGGG - Intronic
922707001 1:227795266-227795288 GGGCACCTCCTGAGGGAAGCCGG - Intergenic
923112568 1:230903920-230903942 CTGAAGCTGCTGAGTGAAAAGGG + Intergenic
923786318 1:237072026-237072048 CTGACCCTGCTGGGGGAAGAGGG + Intronic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
1063248832 10:4252138-4252160 GTGAAGCATCTGAGGGAAGAGGG + Intergenic
1063402174 10:5756610-5756632 CAGAACCTTCTGAGGAAAGGAGG + Exonic
1063549164 10:7012957-7012979 ATTAACCTCCTGAGAGAAGGTGG - Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1064709588 10:18109787-18109809 CTCAAACCCCTGAGGGAAGGGGG - Intergenic
1065951875 10:30659727-30659749 CTCAACCTCCCGAGGGACAAAGG - Intergenic
1067074418 10:43166386-43166408 TTGCGTCTCCTGAGGGAAGATGG + Intronic
1067748134 10:48952001-48952023 CCGAACCACCTGAGGCGAGATGG + Intronic
1068165620 10:53328373-53328395 CTGAAGCTCATGAGGAGAGATGG - Intergenic
1069787443 10:70997890-70997912 CTGACCCTCCTGGGGAAAGAGGG - Intergenic
1070049683 10:72875993-72876015 TTAAACCTCCTGTGGGAAGGAGG + Intronic
1071508715 10:86248076-86248098 CTGAACATTCTGGGGGAAGTGGG - Intronic
1072430254 10:95364911-95364933 CTGAACCTGCTGAGGAACTATGG + Intronic
1075572920 10:123558500-123558522 CTGAACCTTCAAAGGAAAGAGGG - Intergenic
1077337389 11:2011527-2011549 CTGAAGCTGCTGGGGGTAGAGGG - Intergenic
1080021168 11:27561636-27561658 CAGAATCTCCTGAGGGTTGAGGG + Intergenic
1080767455 11:35309891-35309913 CTGAGCCTACTGAGGGACCAAGG + Intronic
1081888624 11:46521184-46521206 CTAAAACTCCTGAAGGAACAAGG + Intronic
1084230477 11:67749086-67749108 CTGAAGGTTCTGAGGAAAGATGG - Intergenic
1084732339 11:71081661-71081683 CTGAGCCTCCAGAGGGAATGAGG - Intronic
1085396098 11:76207928-76207950 CTGCTCCTCCCGAGGGGAGAGGG - Intronic
1087838733 11:102900866-102900888 CTGGCCCTCATGAGGCAAGAAGG + Intergenic
1088498211 11:110454284-110454306 CTGAAGCTTCCTAGGGAAGAGGG + Intronic
1088691864 11:112335184-112335206 ATGAACCTACTCAGGGTAGAGGG - Intergenic
1089828140 11:121298112-121298134 CTTAGCCTCCTGAGGGTAGCTGG + Intronic
1090550904 11:127818918-127818940 CTGAACCTGCCGAGAGAAGTAGG + Intergenic
1202820373 11_KI270721v1_random:66709-66731 CTGAAGCTGCTGGGGGTAGAGGG - Intergenic
1091626100 12:2122082-2122104 CTGGACCTCCTGGAGGCAGAGGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1096686497 12:53291712-53291734 CTGAATGTCCTGAGGGGTGAGGG - Exonic
1096841168 12:54379834-54379856 CTGAACCGCCAGAGGGCAGCAGG - Intronic
1097074713 12:56384333-56384355 CTGTACCTTCTGAGGAAACAGGG + Intergenic
1098689470 12:73468489-73468511 CTGAAGCTACTGAGAAAAGATGG - Intergenic
1099203867 12:79705970-79705992 CTGAACTTCATGGGGGCAGAGGG + Intergenic
1100029536 12:90169022-90169044 CTGAACTTGATGTGGGAAGAAGG - Intergenic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1103331247 12:120155497-120155519 CTCAGCCTCCAGTGGGAAGAAGG - Intronic
1104311816 12:127660176-127660198 CTGAAATTGCTGAGGGGAGAAGG - Intergenic
1106398296 13:29403048-29403070 CTGAACTTCAGGAGGGAAGGAGG + Intronic
1106925092 13:34605481-34605503 ATGACCTTCCTTAGGGAAGAAGG - Intergenic
1109313197 13:60719251-60719273 CAGAACCACCTCAGGGGAGAGGG - Intergenic
1110485621 13:76038217-76038239 CTCAACCTCCAGACGGATGAGGG + Intergenic
1111915942 13:94360432-94360454 TTGGACCTCCTAAAGGAAGATGG + Intronic
1112493301 13:99885829-99885851 CTGAAACTCCTCAGGAAAGGCGG - Intronic
1114391101 14:22309502-22309524 CTGCTCCTGCTGATGGAAGAGGG + Intergenic
1114697474 14:24640396-24640418 CTAAAACTCCTGAGGAAATAAGG + Intergenic
1117365298 14:55021489-55021511 CTCCACCTCCTGAGAGAAGGTGG + Intronic
1118347089 14:64948303-64948325 ACGGGCCTCCTGAGGGAAGAGGG + Exonic
1118464788 14:66021148-66021170 CCTAAACTCCTAAGGGAAGAGGG - Intergenic
1119239238 14:73045150-73045172 CTCAGCCTCCTGAGGGAAGGAGG + Intergenic
1119752284 14:77088067-77088089 CTGACCCGCCTTGGGGAAGAGGG + Intergenic
1119864599 14:77962774-77962796 CTGACCCGCCTTGGGGAAGAGGG - Intergenic
1121828378 14:97029082-97029104 CTGAGACTCCTGAGGGGAAATGG + Intergenic
1122413146 14:101536104-101536126 CTGGGCCTCCTTAGGAAAGAAGG + Intergenic
1122700397 14:103584460-103584482 CAGAATCTCCTGAGTGATGAAGG - Intronic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123192954 14:106588849-106588871 CTGTTACTCCTAAGGGAAGATGG - Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1123794794 15:23760850-23760872 CAGAATCTCCTGAGGGCAGAGGG - Intergenic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1125523373 15:40360305-40360327 CTGAGCCTCCTGAGATCAGAGGG + Intronic
1129472877 15:75764956-75764978 CTGCACCACCTGAGGACAGAGGG + Intergenic
1129926037 15:79365064-79365086 CTCAAACCCCTGAGGGGAGAGGG - Intronic
1131054454 15:89367478-89367500 CTGAGGCTTCTGAGGGCAGAGGG + Intergenic
1133110378 16:3544538-3544560 CTGAACCGCCAGAGGCAAGCAGG + Intronic
1133823687 16:9258943-9258965 ATGAACCTCCTAAGTGAAGTGGG - Intergenic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1135082044 16:19444748-19444770 CAGAACCTACTGGGGGAAAAGGG + Intronic
1135539350 16:23317957-23317979 CTGTACCTTCTGCAGGAAGAAGG - Intronic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1136415430 16:30100337-30100359 CTGAATTTCCTAAGGGAACAAGG + Intergenic
1137036517 16:35574036-35574058 CTGCCCCTCCTGGGGGAAGGCGG + Intergenic
1137392342 16:48092098-48092120 CCGAGCCTCCGGAGGGAAGCTGG + Intronic
1137891419 16:52166606-52166628 TAAAACCTCCTGAGGGCAGATGG + Intergenic
1138345042 16:56315567-56315589 CTGGACCCACTGAGGGGAGAAGG + Intronic
1142600203 17:1050173-1050195 CTCAAACTCCTGGGGAAAGATGG + Exonic
1143259422 17:5586935-5586957 CTCAGCCTCCTGAAGGAATACGG - Intronic
1146402524 17:32511082-32511104 CTGACCCTCAAGAGGGAAGTGGG + Intronic
1147546067 17:41402721-41402743 AGAAACCTCCTGAGGGCAGAGGG + Intergenic
1151084767 17:71367299-71367321 CAGAATCTTCTGATGGAAGATGG - Intergenic
1151152442 17:72099499-72099521 CAGAACCTTCGGAGGGAACATGG - Intergenic
1151966055 17:77432384-77432406 GAGAGCCTGCTGAGGGAAGAAGG - Intronic
1153157864 18:2169308-2169330 CTAACACTCCTGAGGAAAGAGGG - Intergenic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1157393661 18:47324315-47324337 CTGAACCACCTAAGGGGAGGAGG - Intergenic
1157680576 18:49602325-49602347 ATGACCCACCTTAGGGAAGAGGG - Intergenic
1157681140 18:49607994-49608016 ATGACCCTCCTTGGGGAAGAGGG + Intergenic
1157692919 18:49698507-49698529 CTGATCTTCCTGAGTGAAGGGGG + Intergenic
1159611063 18:70526182-70526204 CTGAACCACTGGAGAGAAGACGG + Intergenic
1160240593 18:77119760-77119782 GTGAGCCTCCTGAGGAAATAGGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161392458 19:4028527-4028549 CTGGTCCTCCTGAGGGCAGCTGG - Exonic
1161576976 19:5059717-5059739 CTGAGCCTCATGAGGAAACACGG - Intronic
1163943702 19:20517188-20517210 CTCCACCTGCTGAGGGAAGCCGG - Intergenic
1164143138 19:22492381-22492403 CTCAAACCCCTGAGGGAAGCAGG - Intronic
1164237285 19:23348199-23348221 CAGAATCTCATGAGGGAAAAAGG - Intronic
1164442634 19:28291152-28291174 CAGAACCTCCTAGGGGCAGATGG - Intergenic
1164666963 19:30046498-30046520 CAGAACCTGGTGGGGGAAGATGG + Intergenic
1164834598 19:31349415-31349437 CCGAACGTGCGGAGGGAAGAAGG + Exonic
1165935091 19:39384260-39384282 CTGAACTTTATGAGGGGAGAGGG + Exonic
1167580353 19:50337616-50337638 CTGAACCTACTGAGGGGATGGGG - Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
926178064 2:10614859-10614881 CTGCATCTCCTGTGGGAAAATGG + Intronic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926858659 2:17284676-17284698 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
929484712 2:42343020-42343042 CAGCACCTCCTGAGGTAGGAGGG - Intronic
931035901 2:58242504-58242526 ATGACCCGCCTCAGGGAAGAAGG - Intergenic
931065025 2:58576187-58576209 CAGAAGCTCCCGAGGGAAGCTGG + Intergenic
932741209 2:74292386-74292408 CTAAACCTTCTGTGGGCAGAAGG - Intronic
933389098 2:81648679-81648701 GTGAACCTTCAGAGGGTAGAAGG - Intergenic
935013977 2:99162213-99162235 CTGAATCTAATGAGAGAAGAAGG + Exonic
935242036 2:101187266-101187288 CTGAACTTCATAAGGGAGGAGGG + Intronic
936437491 2:112521055-112521077 CAGAGCCTCCTGAGGCAGGAAGG + Intronic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
941417109 2:165234409-165234431 TTGAACCTACGGAGGGCAGATGG - Intergenic
942098056 2:172552325-172552347 CTGAACCTCATGAAGCCAGAGGG + Intergenic
943718607 2:191179442-191179464 CTGAAACTCCTCAGGGATGAAGG - Intergenic
943892024 2:193300215-193300237 CTTATCCTCCTGAAGAAAGAAGG - Intergenic
946297849 2:218799935-218799957 CTGATCCTCCTTAGAGAAGGAGG + Intronic
948597371 2:239088579-239088601 CTGAAGCACCGGAGGGTAGACGG + Intronic
1168771177 20:417880-417902 CTGCAGCTCCTGAGGGTTGAGGG - Exonic
1168824580 20:801285-801307 CTCAAACCCCTGAGGGAAGGGGG - Intergenic
1171086180 20:22240116-22240138 CTGAAACTCCTGAGAGCTGAAGG - Intergenic
1173377345 20:42498335-42498357 TCTAACCTCCAGAGGGAAGAGGG - Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174049355 20:47757106-47757128 CTGAGGCTCCTGAGGCAAGGCGG - Intronic
1176430379 21:6571730-6571752 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1178590308 21:33904173-33904195 CTGAACCTCCAGCGTGAACAAGG - Intronic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1179705773 21:43179192-43179214 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1179953071 21:44722594-44722616 CTCAACCTACTGAAGGAAGGGGG - Intergenic
1180025189 21:45156752-45156774 TTGAACATGCTTAGGGAAGATGG + Intronic
1181975473 22:26726248-26726270 CTGAACCTCCTGGGAGCAGAAGG + Intergenic
1185404561 22:50640300-50640322 GTGAATCTCCTGAGGGCAGAGGG + Intergenic
950535284 3:13574819-13574841 CTGAGCCTCTTGGGGGAAGTGGG - Intronic
951981147 3:28568350-28568372 CTGAAACTCCTGGGGTAAGTGGG + Intergenic
954498500 3:50988126-50988148 AGGAAGCTCCTGAGGGGAGAGGG + Intronic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
960132939 3:114076729-114076751 CTGAAGAACCTGAGGTAAGAAGG - Exonic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961502209 3:127344530-127344552 ATGCAACTCCTGAGGCAAGACGG - Intergenic
961626279 3:128266074-128266096 ATTAACCTCCTCAGAGAAGAGGG - Intronic
962094102 3:132276068-132276090 ATGAACCGCCTTGGGGAAGAGGG - Intronic
962482522 3:135810009-135810031 CTCAAACCCCTGAGGGAAGGGGG + Intergenic
962771982 3:138620578-138620600 CTCAACCTCCTGGGCTAAGATGG + Intronic
964594282 3:158405732-158405754 GAGAACCACCTGAGGGAATAGGG + Intronic
964663311 3:159145094-159145116 CTGAAACTCCTGACAGATGAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967752296 3:193128482-193128504 CTGCTACTCCTTAGGGAAGAGGG + Intergenic
968359409 3:198136853-198136875 CTGAACCACCTGAGAGGAGGCGG - Intergenic
968629409 4:1642390-1642412 CGGCACCTCCGGAGGGCAGAGGG - Intronic
968761738 4:2445808-2445830 CTGACCCTCATGAGTGAAGTAGG + Intronic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969530895 4:7729591-7729613 CAGAAGCTCCTGAGGGACGCTGG - Exonic
971605488 4:28652237-28652259 CTGAACCAACTGGGGGCAGAAGG - Intergenic
971607518 4:28676931-28676953 CTGAACTGCCTTGGGGAAGAAGG + Intergenic
971911949 4:32805552-32805574 ATGAACCTTCAGAGGGCAGAAGG - Intergenic
972779210 4:42271357-42271379 CTGTAGCTCCTGAGGGGAGGTGG - Intergenic
973020187 4:45195017-45195039 CTTAACCTCCTCAGGCTAGAAGG + Intergenic
973240850 4:47954451-47954473 CTCAAACCCCTGAGGGAAGGGGG - Intronic
974002329 4:56524243-56524265 CTCAAGCTCCTGATGGAAAATGG - Exonic
977649878 4:99457213-99457235 CTCTACCTCCTGAGGGGAGGAGG - Intergenic
978631610 4:110753450-110753472 CTGAACACCCTGTGGGCAGAGGG + Intergenic
978905198 4:113997031-113997053 AGGAACCTCCTGAGGTGAGAAGG + Intergenic
982068895 4:151677944-151677966 ATGAACATCATGAAGGAAGAAGG - Intronic
983521469 4:168713557-168713579 TTGAAACTCCTGAGATAAGACGG - Intronic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
986247804 5:6026956-6026978 CATAACCTCCAGAGAGAAGAAGG + Intergenic
986331701 5:6721113-6721135 CTGAGTCTCCTCAGGGAAGGAGG + Intronic
987786089 5:22500707-22500729 CTTAACCTCGTAAGGGAATATGG - Intronic
990232870 5:53734048-53734070 CTGGAACTGCTGAGGGAGGATGG - Intergenic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
992945181 5:81802771-81802793 CTGACCTCCCTGAGGCAAGAAGG - Intergenic
994574526 5:101560383-101560405 CTGAACCTTGTGAGATAAGAAGG + Intergenic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001407672 5:171487314-171487336 CTTGGCCTCCTGGGGGAAGAAGG + Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1003260137 6:4509613-4509635 CTGACCCTACTGGGGGAACAGGG - Intergenic
1003925796 6:10876596-10876618 CAGACCCTTCTGAAGGAAGAAGG + Intronic
1004122166 6:12834355-12834377 CTCAAACTCCCCAGGGAAGAAGG - Intronic
1004491609 6:16122567-16122589 CTGAACCAGGTGAGAGAAGAGGG - Intergenic
1006140433 6:31925962-31925984 CTCATCCTCCTGGTGGAAGACGG + Intronic
1006374509 6:33664403-33664425 CTGAAACTCTTGGGGGTAGATGG + Intronic
1006400335 6:33813841-33813863 CTGCACCTCCTGAGAGAAAGTGG - Intergenic
1006436633 6:34029161-34029183 CTGAACCTCCTCAGCCAAGGTGG + Intronic
1012626397 6:101408635-101408657 CTGACCCTCCTGAGAAAAAAAGG - Intronic
1015256518 6:131184394-131184416 CTGAGCCCCCTGAAGGAAGTTGG - Intronic
1015843710 6:137497132-137497154 CTGAAAACCCTTAGGGAAGAAGG - Intergenic
1016340651 6:143058946-143058968 CTGGACCTCCTGAGACAAGTGGG + Intergenic
1016672079 6:146720930-146720952 CTGAAGCTCCTGTGGAAAGAAGG + Intronic
1016687314 6:146896008-146896030 GTGAACCTCAGGAGGGAAGAGGG - Intergenic
1016799647 6:148155922-148155944 CTGTACCTCCTGTGGCAAGGAGG - Intergenic
1016890154 6:148998069-148998091 CTGAACCTCTTCAGCTAAGAAGG + Intronic
1017451993 6:154562933-154562955 CTCAACCACCAGAGGCAAGATGG + Intergenic
1017546922 6:155462242-155462264 CTGAACCTGCTGAGTGACGTTGG - Intergenic
1017826251 6:158084185-158084207 CTGAGGCTCCTGAGAAAAGAAGG - Intronic
1017835169 6:158170485-158170507 CTGAACCTTCTGAGAAAACATGG + Exonic
1017942370 6:159064143-159064165 CTGAACCTTCTCATGAAAGATGG + Intergenic
1019260590 7:79823-79845 CTGAACCACCTGAGAGGAGGCGG + Intergenic
1021030304 7:15724572-15724594 CTCACCCTCCTGGGGGAAGGAGG - Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022379652 7:29847840-29847862 ATGACCCTCCTTGGGGAAGAGGG + Intronic
1022403844 7:30067746-30067768 CTGAAAATACTGAGTGAAGAAGG - Intronic
1022475781 7:30708639-30708661 CTGAACCCCCTCAGGGAGGCAGG - Intronic
1023438119 7:40159326-40159348 GTGACCCTTCTTAGGGAAGAGGG + Intronic
1023863411 7:44228063-44228085 CTGAAGCTGCTGGGGGCAGAGGG + Intronic
1024500440 7:50099873-50099895 TTTAACCCCCTGGGGGAAGATGG - Intronic
1027112604 7:75452821-75452843 CTCCACCTCTTCAGGGAAGAGGG - Intronic
1027284850 7:76637427-76637449 CTCCACCTCTTCAGGGAAGAGGG - Intergenic
1027453606 7:78360707-78360729 CTGTCCCTCCTGCTGGAAGAGGG - Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1033772088 7:144564011-144564033 CTGGCACTGCTGAGGGAAGAAGG + Intronic
1036471025 8:9052940-9052962 CTCAACCTCTGGAGAGAAGAGGG + Intronic
1038578929 8:28730094-28730116 CTGGACCTCCAGGGGGAGGATGG + Intronic
1041275938 8:56157422-56157444 CCCAACCCCCTGAGGGAGGAGGG + Intergenic
1047044202 8:121033633-121033655 CTGATCCTTGTGAGGGAAAATGG + Intergenic
1047495429 8:125405426-125405448 CTGAGACTCCTGAGGACAGAGGG + Intergenic
1048808985 8:138268041-138268063 CTGACCCTCCTGGTGGCAGACGG - Intronic
1049676223 8:143890467-143890489 TGGAACCTCCTGTGGGAAGGGGG + Intergenic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049703118 8:144023950-144023972 TAGAAGGTCCTGAGGGAAGAGGG - Intronic
1050019766 9:1270720-1270742 CAGAATCTCCTAAGGGCAGAAGG - Intergenic
1050583972 9:7090728-7090750 CTATACCTGCTGAGGGAAGGAGG - Intergenic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1056710675 9:88990336-88990358 CTGATCCTCTGGAGGCAAGAGGG + Intergenic
1057283113 9:93726882-93726904 CTGAGCCTGCTGAGTGCAGATGG - Intergenic
1057571933 9:96211096-96211118 TCCAGCCTCCTGAGGGAAGAGGG + Intergenic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1059938563 9:119335839-119335861 CTGTACCTCCTGAAGGTAGAAGG - Intronic
1060003896 9:119982685-119982707 CTGATCCTCCTCAGGAAGGAAGG + Intergenic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1060498945 9:124138341-124138363 AGGAACCACCTTAGGGAAGAAGG + Intergenic
1060775586 9:126371427-126371449 CTGCACCTCCTGATGGCCGAAGG - Intronic
1061392797 9:130327181-130327203 CTGGACCTCCTGAAGGTCGAGGG + Intronic
1061887818 9:133601643-133601665 CAAAACATCCTCAGGGAAGAAGG - Intergenic
1061986114 9:134131295-134131317 CAGCACCACCTGGGGGAAGAGGG + Intergenic
1062138681 9:134943764-134943786 CAGGACCTCGGGAGGGAAGAAGG - Intergenic
1062744096 9:138200567-138200589 CTGAACCACCTGAGAGGAGGCGG - Intergenic
1189229330 X:39440047-39440069 CTGAACAGGCTGAGGGAACAGGG + Intergenic
1190533659 X:51406379-51406401 CTGAACATCCGGAGGCAAGACGG + Intergenic
1194236677 X:91392856-91392878 CTGAATCTGATGATGGAAGAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195705422 X:107734686-107734708 CTGAAGCAAGTGAGGGAAGAGGG + Intronic
1196306789 X:114112239-114112261 CTGACCCTCCTTGGGGAAGAGGG + Intergenic
1196392710 X:115225221-115225243 GTGATCCTCCTTGGGGAAGAGGG + Intronic
1197253632 X:124239958-124239980 CAGAAGCTCCTGAAGGGAGAAGG + Intronic
1198543168 X:137662042-137662064 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1200083924 X:153593516-153593538 CTGAGCATCCTGGGGGAAGGTGG - Intronic
1201474470 Y:14365496-14365518 CTGTACCTCCTCAGGCAAGCAGG + Intergenic
1201571028 Y:15414610-15414632 CTGAGCCTTCTTAGGGAAGAGGG + Intergenic