ID: 905908914

View in Genome Browser
Species Human (GRCh38)
Location 1:41640454-41640476
Sequence TGCAGCTGGACCTCAAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905908914_905908922 19 Left 905908914 1:41640454-41640476 CCCACATTTGAGGTCCAGCTGCA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 905908922 1:41640496-41640518 ACAAGACACTCTCCATCACTGGG 0: 1
1: 0
2: 1
3: 13
4: 163
905908914_905908921 18 Left 905908914 1:41640454-41640476 CCCACATTTGAGGTCCAGCTGCA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 905908921 1:41640495-41640517 GACAAGACACTCTCCATCACTGG 0: 1
1: 0
2: 1
3: 18
4: 247
905908914_905908917 -4 Left 905908914 1:41640454-41640476 CCCACATTTGAGGTCCAGCTGCA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 905908917 1:41640473-41640495 TGCACCCAGCTAAGTGACCTTGG 0: 1
1: 0
2: 2
3: 14
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905908914 Original CRISPR TGCAGCTGGACCTCAAATGT GGG (reversed) Intronic
901097821 1:6696515-6696537 TGCAGCTCAAACTCAACTGTTGG + Intronic
901318399 1:8324228-8324250 TGCAGTGTGAACTCAAATGTTGG + Intronic
902614983 1:17618784-17618806 TGGAGCTGGACCTCAGACGGAGG - Intronic
904341026 1:29834707-29834729 TGGAGCTGGACTTCAAACCTGGG - Intergenic
905281372 1:36851579-36851601 TGCAGTTGGAGCTCAAGTGAGGG - Intronic
905908914 1:41640454-41640476 TGCAGCTGGACCTCAAATGTGGG - Intronic
906225247 1:44116722-44116744 TTCTGCTGGGCCTTAAATGTAGG + Intergenic
907776096 1:57516833-57516855 TGCAGCTGGACTTGAAGTGGGGG - Intronic
910489272 1:87750565-87750587 TGAAGCTGGATGTCAAATCTGGG + Intergenic
913610688 1:120506947-120506969 TGTAGCTGGTTCTCAAATGTGGG + Intergenic
913984111 1:143549867-143549889 TGTAGCTGGTTCTCAAATGTTGG - Intergenic
914412070 1:147438894-147438916 TTCTGCTAGACCTCTAATGTTGG - Intergenic
914580502 1:149015292-149015314 TGTAGCTGGTTCTCAAATGTGGG - Intronic
917549600 1:176010776-176010798 TGCAGCTAAATGTCAAATGTCGG + Intronic
918537894 1:185594646-185594668 TTCAGCTGGACCTTGAAGGTAGG - Intergenic
919649015 1:200127125-200127147 TGGATCTGAACCTAAAATGTTGG - Intronic
923755474 1:236787168-236787190 TGCAGCTGGGCCTCAAACCCAGG - Intergenic
1063538972 10:6912846-6912868 TGGAGCTAGACCTGAAATGTAGG - Intergenic
1066499132 10:35973012-35973034 TGCAGCTGAATCTCAAAACTTGG - Intergenic
1066499136 10:35973056-35973078 TACAGCTGAACCTCAAAACTTGG - Intergenic
1066626968 10:37416913-37416935 TGCAGCTGAACCTCAAAACTTGG - Intergenic
1066626970 10:37416957-37416979 TACAGCTGAACCTCAAAACTTGG - Intergenic
1068172924 10:53419808-53419830 TGCAGATGGACACCAAAAGTGGG - Intergenic
1070917817 10:80166285-80166307 TGCTGCTGTTCCTCAAATCTGGG - Intronic
1070998464 10:80807767-80807789 CACCGCTGGACCTCAAAGGTGGG + Intergenic
1073044915 10:100631398-100631420 TACAGCTGGACCTTAAAGTTAGG - Intergenic
1073705153 10:105974858-105974880 TGCATGTGGCCTTCAAATGTTGG - Intergenic
1077982944 11:7319824-7319846 TGCAGCTGGAGCTTGAATGGAGG - Intronic
1078050731 11:7962955-7962977 TGCAGCTGGAGGTAAGATGTGGG + Intronic
1079667672 11:23128158-23128180 TGCTGCTGGAACTCTAATTTGGG - Intergenic
1081537154 11:44004423-44004445 AGCAACTGGAGCTCAAATTTTGG - Intergenic
1082214990 11:49558616-49558638 TGCAGCTGGAGCGCTAGTGTCGG - Intergenic
1085295243 11:75427787-75427809 TTCAGCTGGACCTTGAAAGTTGG - Intronic
1085659116 11:78346502-78346524 TGGAGCTGGGATTCAAATGTAGG + Intronic
1086634591 11:89065853-89065875 TGCAGCTGGAGCGCTAGTGTCGG + Intronic
1089767565 11:120779056-120779078 TGCACCAGGACCTCAGTTGTGGG + Intronic
1094747916 12:33367893-33367915 TGGAGCTGGGCCTCAAATCTAGG - Intergenic
1096370568 12:51065743-51065765 TGCAGCTGGGCCTGGCATGTTGG - Intronic
1099764478 12:86965244-86965266 TGCTGCTGTACCTCGAAGGTGGG - Intergenic
1099785031 12:87251186-87251208 TGCAGGAGGACCTTAAATGACGG + Intergenic
1100714361 12:97290124-97290146 TGCACCTGCAAGTCAAATGTTGG + Intergenic
1104109076 12:125688843-125688865 TGCTGCTGGTCCTCACATGCAGG - Intergenic
1104161845 12:126188862-126188884 TGGAGCTGGAATTCAAATGCAGG - Intergenic
1104427936 12:128693355-128693377 TGCAGCTGTAGCTGAAATCTGGG - Intronic
1108591266 13:51914841-51914863 TGAAGCTGGAGTTCAAACGTGGG - Intergenic
1112718557 13:102215184-102215206 TGCAGCTGGACCAGAAGAGTGGG - Intronic
1113320143 13:109225172-109225194 TGCTTCTGGACCTCAAACATTGG - Intergenic
1113626853 13:111854127-111854149 AGCAGATGGAGCTCAGATGTCGG + Intergenic
1120155841 14:81092314-81092336 TGCACCTGGAGCCCAAATGTGGG - Intronic
1120644827 14:87061353-87061375 TGCAGTTGAAACCCAAATGTAGG - Intergenic
1121443280 14:93962509-93962531 TGGGGCTGGACCTCAGATGAGGG + Intronic
1124130852 15:26984291-26984313 TGCAGTTGGACCACGTATGTTGG - Intronic
1125305122 15:38303140-38303162 TGCCACTGCACCTCCAATGTGGG + Intronic
1128296655 15:66526398-66526420 TTCAGTTGCAACTCAAATGTGGG - Intronic
1128920010 15:71602031-71602053 TTCAGCTGGATCTTAAATGTTGG + Intronic
1134218168 16:12332650-12332672 TGCAGGTGGACCTGGAAGGTGGG - Intronic
1137836269 16:51595640-51595662 TGCAGCTGGAACTGAGATCTTGG + Intergenic
1141344638 16:83233585-83233607 TGCAGGTGGCCCCCAAAAGTTGG - Intronic
1144823540 17:18092053-18092075 TTGAGCTGCACCTCAAATGATGG + Intronic
1145825522 17:27874480-27874502 TGCAGTTGGGCCCCAAAGGTAGG - Intronic
1148440180 17:47708223-47708245 TTGAGCTGGACCTTAAAGGTAGG + Intronic
1149636555 17:58175312-58175334 TGCAGTTGGACATCAGGTGTTGG - Intergenic
1156313680 18:35948305-35948327 AGCAACTGAACCTCAATTGTTGG - Intergenic
1157351440 18:46890675-46890697 GGCTGCTGCATCTCAAATGTGGG + Exonic
1158302474 18:56067050-56067072 GGAAGCTGAACCTGAAATGTGGG - Intergenic
1158391229 18:57046803-57046825 TGCTGCTGGACCTTGAAGGTTGG + Intergenic
1162332657 19:10039636-10039658 ACCAGCTGGACCTCAAAAGATGG - Intergenic
1163083859 19:14964636-14964658 TGCAGATGGCCCTCAAATCCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
925054062 2:842434-842456 CACAGCTGGACCCCAAAAGTGGG - Intergenic
925405361 2:3602529-3602551 GGCAGCTGGACCCCACGTGTGGG - Intronic
926166524 2:10524610-10524632 TGCCTCTGGACCTCAGATGCCGG + Intergenic
927009043 2:18882311-18882333 TGCTTCTGGTCCTCAAATATTGG + Intergenic
927146595 2:20170158-20170180 GGTAGCTGGACCTCTTATGTGGG + Intergenic
929644342 2:43611940-43611962 TGAGGCTGGACATCAAATGGAGG - Intergenic
932878282 2:75475462-75475484 TGCAGCTGAACCATAAAGGTGGG - Intronic
934647987 2:96070443-96070465 TGCATCTGGAACTCAGATGGGGG - Intergenic
934841362 2:97626264-97626286 TGCATCTGGAACTCAGATGGGGG - Intergenic
938230750 2:129656658-129656680 TGCAACTGAAACCCAAATGTTGG - Intergenic
940000594 2:148963276-148963298 TGCAGCTGTACCTCAGCTTTGGG + Intronic
940112775 2:150171980-150172002 TTCAGCTGGACCTTAACTGTGGG - Intergenic
943658898 2:190536525-190536547 TGCACCTGAACCTTAGATGTGGG - Intergenic
945929307 2:215839479-215839501 AGCAGCTGGAGCTCAACTGCTGG - Intergenic
946754328 2:222928558-222928580 TTCTGCTGTACCTGAAATGTGGG + Intronic
946813769 2:223554566-223554588 TGCTGCTGGACCTCTAAGGATGG + Intergenic
948557626 2:238824519-238824541 TGCATCTGGGCCTCAAAGGTGGG - Intergenic
1171458797 20:25286960-25286982 TGCAGCTGCCCCTTAAATGCTGG - Intronic
1175440601 20:58988384-58988406 TGCAGCAGGGCCTCAAAAGCAGG - Intronic
1179595136 21:42438269-42438291 TGCAGCAGGAGGGCAAATGTGGG + Intronic
1180004039 21:45011722-45011744 TGCGGCTGCTCCTCAAATTTTGG - Intergenic
1180853534 22:19033110-19033132 TGCAGCTGCACTTCAACTGCCGG - Intergenic
1182208845 22:28656262-28656284 TAAAACTGGTCCTCAAATGTTGG + Intronic
1184090267 22:42289602-42289624 TGAAGCTGCAACTCCAATGTGGG + Intronic
1185390231 22:50556443-50556465 TGGAGCTGGATTTGAAATGTAGG - Intronic
949110392 3:254056-254078 AGCAGCTGGTTCTCAAAGGTCGG - Intronic
950862980 3:16166765-16166787 GACACCTGGACCTCAAATGAGGG + Intergenic
951599415 3:24356694-24356716 TACAGCAGCACCTCAATTGTTGG + Intronic
952791252 3:37202265-37202287 TGGAGCTGGGCCTCAGAAGTGGG + Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
961053153 3:123764624-123764646 TGCAGCTGTACCTCATGTCTAGG + Intronic
961463867 3:127069938-127069960 TGCTGCTGGTCCTCCAGTGTGGG + Intergenic
965797923 3:172460516-172460538 TGCAGCTGGAACACAAAGATGGG - Intergenic
966018575 3:175176762-175176784 TGCAGATGGACCTTAGAAGTGGG + Intronic
967403410 3:189088551-189088573 TTGACCTTGACCTCAAATGTCGG + Intronic
968606157 4:1536693-1536715 TGAAGCTGGACCTCATCAGTGGG + Intergenic
973944127 4:55940351-55940373 TGAAGCTGGACCCCCAATATTGG + Intergenic
975978542 4:80127737-80127759 TGAAGCTTCAACTCAAATGTTGG + Intergenic
989084945 5:37666087-37666109 GGCAGCTGGACTTCAAAGGGGGG + Intronic
992098453 5:73382687-73382709 TGCTGCTGGATGTTAAATGTGGG - Intergenic
999471343 5:151857800-151857822 TGCAGCAGGCACTCAGATGTTGG - Intronic
999756896 5:154671175-154671197 TTCAGCTGAACCTCAAATCCTGG + Intergenic
1000648810 5:163790200-163790222 TGCAGCTGCACAGCAAATGCTGG + Intergenic
1001273354 5:170332120-170332142 TGCAGGTGGACCACAAAAGTGGG - Intergenic
1002693296 5:181065923-181065945 TGCAGCTAACCCTCAAAAGTAGG + Intergenic
1002876953 6:1219184-1219206 TGCAGCTGGGCCTCATGTGAAGG + Intergenic
1003778203 6:9393084-9393106 AACAGGTGGACATCAAATGTGGG + Intergenic
1007782984 6:44264820-44264842 CCTAGCTGGACCTCAAAAGTGGG + Intronic
1008957195 6:57228707-57228729 TACAGCTGGAATTCAAATATAGG - Intergenic
1009689757 6:67013951-67013973 TGCAACTTAACCTCAAATATTGG - Intergenic
1009846994 6:69146455-69146477 TGCAGCTGCACCTCAGAGGGTGG + Intronic
1011017067 6:82768691-82768713 TGCTGCTGGCTCTCAGATGTAGG - Intergenic
1014340211 6:120196152-120196174 TGCAGCTGGAACTGAAATAAAGG - Intergenic
1015201366 6:130585112-130585134 TGCAACTTGACCTAAAATGCAGG + Intergenic
1016385745 6:143529357-143529379 TTCAGCAGGAGCCCAAATGTGGG - Intergenic
1016940696 6:149481007-149481029 TGCAGGTGGACCTCAGCTGAGGG - Intronic
1017078486 6:150642698-150642720 TGCTGTTGGTGCTCAAATGTTGG + Intronic
1018417145 6:163611579-163611601 TGCAGGTGGACCTCAGGTGTAGG + Intergenic
1018417153 6:163611613-163611635 TGCAGGTGGACCTCAGGTGTGGG + Intergenic
1018417166 6:163611664-163611686 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1018417183 6:163611732-163611754 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1018417192 6:163611766-163611788 TGCAGGTGGACGTCAGGTGTGGG + Intergenic
1018417205 6:163611817-163611839 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1018417219 6:163611868-163611890 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1018417247 6:163611970-163611992 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1018417286 6:163612123-163612145 TGCAGGTGGGCCTCAGGTGTGGG + Intergenic
1019466162 7:1190466-1190488 TGTAGGTGGGACTCAAATGTAGG + Intergenic
1021202925 7:17745734-17745756 TGCAGATGGGCCTCAAAGCTAGG - Intergenic
1021539802 7:21744811-21744833 TGCAGCTGGACCTCTATGGATGG + Intronic
1021566019 7:22017303-22017325 TGCAGCTGAGCCTGGAATGTGGG - Intergenic
1023793309 7:43770853-43770875 TGCAGCTGCTCTTCCAATGTAGG + Intronic
1024933751 7:54691086-54691108 TGCAGCAGGAGCTCAAAGGCGGG + Intergenic
1025776885 7:64568469-64568491 TGCAGCTGGCCCACAGGTGTGGG - Intergenic
1028899661 7:96083423-96083445 TGCAGCTAAGCCTCAGATGTAGG - Intronic
1029661702 7:101966689-101966711 TGCAGGTGGCCCTCACCTGTCGG - Intronic
1032941694 7:136800302-136800324 TCCAGCTGGATAACAAATGTGGG - Intergenic
1034196678 7:149253814-149253836 TACAGCTGGACCAGGAATGTGGG + Exonic
1036459075 8:8936093-8936115 AGCAGCTGATCCTCCAATGTGGG - Intergenic
1038537921 8:28367856-28367878 TGCTGCTGGCCCTAAAATGAAGG + Intronic
1039271488 8:35886059-35886081 TACAGCTAGAATTCAAATGTAGG + Intergenic
1040733952 8:50483758-50483780 TGCAGCTGCAAATCTAATGTGGG + Intronic
1041954624 8:63543695-63543717 TGCAGCTGGGACTCAAGGGTTGG + Intergenic
1048909125 8:139117469-139117491 TTCACCTGGATGTCAAATGTTGG + Intergenic
1050107842 9:2184071-2184093 TGCAGGGGAACCTCAAAGGTTGG - Intronic
1051176494 9:14366197-14366219 TGCAACTGGATCTCAATTCTGGG - Intronic
1051366612 9:16325781-16325803 TGCATCTGGTTCTCAAATGGTGG - Intergenic
1051880769 9:21837618-21837640 TGCAGGTGCAACTCAACTGTGGG - Intronic
1053239314 9:36483660-36483682 GACGGCTGAACCTCAAATGTTGG + Intronic
1055086961 9:72324144-72324166 TGCAGCTGGGACTCAAATCTAGG - Intergenic
1058191322 9:101919553-101919575 TGCAGCTGGATCTCAAGACTTGG + Intergenic
1058229944 9:102413291-102413313 TTCTTCTGGCCCTCAAATGTTGG - Intergenic
1059715792 9:116912142-116912164 TGCAGCTGGAGGACACATGTAGG - Intronic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1189385977 X:40537251-40537273 TGCACCTGGACCCCGAGTGTTGG + Intergenic
1196200440 X:112880589-112880611 TGCAGATTGACCTCAAATTTAGG + Intergenic
1198688319 X:139251369-139251391 TGCACTTGGGCCTCAAACGTAGG - Intergenic
1199264377 X:145813476-145813498 TGCAGCTGGAAGTCATATTTTGG - Intergenic
1202164607 Y:21973458-21973480 TGCAGCATGCCCACAAATGTTGG - Intergenic
1202226749 Y:22612914-22612936 TGCAGCATGCCCACAAATGTTGG + Intergenic
1202316372 Y:23582746-23582768 TGCAGCATGCCCACAAATGTTGG - Intergenic
1202554392 Y:26087312-26087334 TGCAGCATGCCCACAAATGTTGG + Intergenic