ID: 905910038

View in Genome Browser
Species Human (GRCh38)
Location 1:41647431-41647453
Sequence CTGTGGAAACAGCTTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905910038_905910041 24 Left 905910038 1:41647431-41647453 CCGGGCACAAGCTGTTTCCACAG 0: 1
1: 0
2: 3
3: 12
4: 216
Right 905910041 1:41647478-41647500 CAGAAATAACCCCACTGACATGG 0: 1
1: 1
2: 0
3: 28
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905910038 Original CRISPR CTGTGGAAACAGCTTGTGCC CGG (reversed) Intronic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
901636462 1:10672500-10672522 CTTTGAAAACAGATTGGGCCCGG - Intronic
902097975 1:13962169-13962191 CTGTGGGAACAGCCTGTGCCGGG + Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902592811 1:17487246-17487268 CGGTGGGGACAGCTTGAGCCTGG - Intergenic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
904809289 1:33152935-33152957 CTGAGGAGGCAGTTTGTGCCTGG + Intronic
904854799 1:33489580-33489602 CTGTGGGAACAGCGTGTGCCTGG + Exonic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906640184 1:47437058-47437080 CTGTGGAAACGGCATTTGTCTGG - Exonic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
909575826 1:77174805-77174827 CTGTAGAAACTGCATGTTCCTGG + Intronic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
919839716 1:201600001-201600023 CCGAGGAGACAGCTTGGGCCCGG + Intergenic
920036737 1:203070719-203070741 CTGTGGATACTGGTTGTCCCTGG - Intronic
920229973 1:204463780-204463802 CTGTGGAAAGAGCTTGGAGCTGG - Intronic
921415910 1:214886607-214886629 CTCAGGGAACAGCATGTGCCAGG - Intergenic
1063753214 10:8975956-8975978 CTGTGACTCCAGCTTGTGCCTGG + Intergenic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1067701204 10:48573940-48573962 CAGTGGAAATTGATTGTGCCTGG + Intronic
1068984646 10:63095911-63095933 CTGAGGAAACAGCATTTGGCCGG + Intergenic
1069949576 10:72009710-72009732 CTGTGGTTACAGCCAGTGCCTGG + Exonic
1070480235 10:76875178-76875200 CTTTGGCAAAAGCTGGTGCCTGG - Intronic
1070575302 10:77672903-77672925 CTGTGGAAGAAGCTTTAGCCTGG + Intergenic
1070841232 10:79489374-79489396 CTCTGGGAACAGATTGAGCCAGG - Intergenic
1073511713 10:104046681-104046703 CTGGGGTAACTGCTTGGGCCAGG - Intronic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076800707 10:132826735-132826757 CTGTGGCTCCAGCTTCTGCCTGG - Intronic
1077695656 11:4390298-4390320 GTGTGGCCACAGCTTCTGCCAGG - Exonic
1078133647 11:8634637-8634659 CTTAGGCAACAGCTGGTGCCAGG + Intronic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1081543920 11:44056291-44056313 CAGTTGACACAGCTTGTGCTGGG - Exonic
1081670873 11:44941845-44941867 CCGTGGACACAGCCTGGGCCTGG - Intronic
1081771633 11:45653817-45653839 CTGTGAAAGAAGCATGTGCCTGG - Intronic
1082975460 11:59066262-59066284 CTGAGGAAACACTGTGTGCCTGG + Intergenic
1083235880 11:61350475-61350497 CTGTCTGAACAGCTTGGGCCTGG - Intronic
1083996338 11:66274865-66274887 CTGGGGAGCCAGCATGTGCCAGG - Intronic
1085277277 11:75308116-75308138 CTGTGGAAGTTGCTTGGGCCGGG - Intronic
1086599419 11:88614348-88614370 CTTAGGAAGCATCTTGTGCCAGG - Intronic
1089127808 11:116189646-116189668 CTGTGCAAACCCCTTGTGTCAGG - Intergenic
1090210055 11:124912884-124912906 CTCTGTAAACAGCTCATGCCAGG + Intergenic
1095797739 12:46238734-46238756 CTGAGGACACAGCTAGTGGCTGG + Intronic
1096690893 12:53321216-53321238 GAGTGGAAACAGCTTGGCCCCGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1101044157 12:100787325-100787347 CATTGGAAAAAGCCTGTGCCAGG + Intronic
1102455530 12:113068612-113068634 CTGTGCAGACAGCTTGTGATGGG + Intronic
1106177316 13:27342454-27342476 CTGTGGACACAGCTGGTCACAGG + Intergenic
1106241337 13:27916059-27916081 AAGTGGAAAGAGCTCGTGCCTGG + Intergenic
1106805742 13:33304994-33305016 CTGAGGAAACAGCCTGTGAGAGG + Intronic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1110164890 13:72429484-72429506 CTGAGGAAACAGCAAGTGCTTGG + Intergenic
1110432958 13:75446949-75446971 GGGTGGGAACAGGTTGTGCCAGG + Intronic
1112599333 13:100839913-100839935 CTGTGGAAATGGCTGCTGCCAGG - Intergenic
1112666382 13:101579303-101579325 CTGTGGAAACTGCTACTGCAAGG + Exonic
1114533189 14:23408081-23408103 CTGTGGAACCTCCTTGTGTCAGG + Intronic
1114835839 14:26202298-26202320 AAGTGGAAACAGCTTTTGACTGG - Intergenic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1116692373 14:48125821-48125843 CTGTCCACACAGCTTGTGTCTGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1121405341 14:93716231-93716253 CTGTGGACACCACTTGTGCCAGG + Intergenic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121544390 14:94752749-94752771 CGGTGGGAAGAGCTTGTGTCTGG - Intergenic
1122207790 14:100156825-100156847 CTGGGGGAACAGCTTGTGCCGGG + Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126317564 15:47386686-47386708 CTCTGGGAACACCTGGTGCCAGG + Intronic
1126896786 15:53266335-53266357 CTGTGGTCACAGCTTTTGCAAGG - Intergenic
1127850397 15:62907135-62907157 CTGTGGTAGGAGCTGGTGCCTGG - Intergenic
1127920923 15:63493537-63493559 CAGAGGAAACAGCTCGAGCCAGG + Intergenic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1129176078 15:73840716-73840738 CTATGAGAAGAGCTTGTGCCCGG + Intergenic
1132533724 16:467028-467050 CTGTCGAACCAGCCTGTTCCAGG + Intronic
1132662716 16:1068785-1068807 CTGTGGACTCAGCCTGTGCTGGG - Intergenic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138480714 16:57301323-57301345 CCCTGGAAACAGCCTGTGCGCGG - Intergenic
1141758716 16:86012603-86012625 CTGTGGAATCAGATTCTTCCAGG + Intergenic
1141776657 16:86127659-86127681 CTGTCTAAACAGCGTGTGTCTGG + Intergenic
1142737291 17:1908887-1908909 CTGGAGAAACAGCTTGTAACCGG - Intergenic
1143715935 17:8769032-8769054 CAGTGGCAACAGGGTGTGCCGGG - Intergenic
1143952002 17:10640376-10640398 CTCTGCACACAGCTTGTGTCCGG + Exonic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148808969 17:50278580-50278602 CTGTGGTGACAGCTGCTGCCAGG + Exonic
1148985689 17:51619022-51619044 TTGTGGACAAGGCTTGTGCCTGG + Intergenic
1151448135 17:74180644-74180666 CTGTGGAACCACCTGCTGCCTGG - Intergenic
1152371581 17:79891812-79891834 GTGTGGAAACAGCTCATGACTGG + Intergenic
1152989005 18:345232-345254 CTGTGAAAATAGTTTGTGACTGG + Intronic
1153068070 18:1070192-1070214 CTGTGGAAACAAATTATTCCTGG + Intergenic
1157343740 18:46804425-46804447 ATGTGGAAACAGATTCTGACAGG - Intergenic
1157580670 18:48772126-48772148 CTCTGGAACCAGCCTGTGCATGG + Intronic
1157731997 18:50011904-50011926 CTCTGGGAACAGCTCGTGCAGGG - Intronic
1157799193 18:50605265-50605287 CTGGGGAAACATCTTTTCCCTGG + Intronic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1161613470 19:5257031-5257053 TGGTAGAAACAGCTTCTGCCAGG - Intronic
1161639990 19:5416181-5416203 CTGTGGAAAAAGAGTGTGGCAGG - Intergenic
1161807721 19:6454626-6454648 TGGTGGAAACAGCTGGTGGCCGG - Exonic
927111959 2:19869756-19869778 CTGTGAAGACAGCCTGTGCCAGG - Intergenic
928077960 2:28282445-28282467 TTGTGGAAAGAGCTTCTGCTTGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929227550 2:39526136-39526158 CTCGACAAACAGCTTGTGCCAGG + Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932039569 2:68284971-68284993 TAGTGAAAACAGCTTGGGCCTGG - Intronic
932606130 2:73166807-73166829 TTGTGGAGCCAGCTTCTGCCAGG - Intergenic
933926298 2:87093644-87093666 TTGTGGAGCCAGCTTCTGCCAGG + Intergenic
935577593 2:104726846-104726868 CTATGGAAACAACTAGTCCCTGG - Intergenic
940988937 2:160078156-160078178 CTGGGGGACCTGCTTGTGCCAGG - Intergenic
941422423 2:165299222-165299244 CTAAGGACACAGTTTGTGCCAGG + Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942521289 2:176806989-176807011 GTGTGGAAACAGTTTGTGATAGG - Intergenic
948175846 2:235942171-235942193 CTGTGTAGACAGCTCATGCCAGG + Intronic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1169468358 20:5861252-5861274 CTGTGGAAACATGCAGTGCCAGG - Intronic
1169494922 20:6106214-6106236 CTGTGGACCAAGCTTGTGTCTGG - Intronic
1170463492 20:16601144-16601166 ATGTGGAGACTGCATGTGCCTGG - Intergenic
1170569082 20:17622767-17622789 CTGGGGTAACAGCCTGTGTCTGG + Intronic
1170591355 20:17774275-17774297 CTGTGGACAGACCCTGTGCCCGG + Intergenic
1171973715 20:31580519-31580541 CTGTAGAAACAGACTGTGCGGGG - Intergenic
1172550048 20:35791988-35792010 CAGTGGAAAGGGCCTGTGCCAGG - Intronic
1173248265 20:41350718-41350740 CAGAGGAAACAGTATGTGCCAGG + Intronic
1173328094 20:42051884-42051906 GTCTGGAAATTGCTTGTGCCAGG - Intergenic
1175890377 20:62313326-62313348 CTGTGGACAGGCCTTGTGCCCGG - Exonic
1176063575 20:63182763-63182785 CTGTGGAAATGGCTTGTGGTGGG - Intergenic
1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG + Intronic
1182471514 22:30551280-30551302 CTGTGCAACCAGCCTCTGCCAGG - Intergenic
1182997534 22:34827914-34827936 TTCTGGAAACAGCTTCTGCATGG + Intergenic
1184639950 22:45865408-45865430 CTGTGGAAGCAGCATGGACCCGG + Intergenic
950538325 3:13594676-13594698 CCCAGGAAACAGCTTTTGCCAGG + Intronic
953450300 3:42999857-42999879 CTGTGTTACTAGCTTGTGCCAGG + Intronic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
954700230 3:52446981-52447003 CTGCGGAAAGAGCCTGTGGCAGG + Intergenic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
955506006 3:59633790-59633812 ATGTGGCTTCAGCTTGTGCCAGG + Intergenic
956366179 3:68505661-68505683 CTGGGGACCCAGCTTGTTCCTGG + Intronic
956731928 3:72204190-72204212 CTGTGGAAACAGCCTGAGCTGGG - Intergenic
958795015 3:98698124-98698146 TTCTGGCAACAGCTTGTGGCAGG - Intergenic
964985568 3:162733473-162733495 GTGTGTAAACAGCATATGCCAGG + Intergenic
965513053 3:169590411-169590433 CTGTGGGAGCAGATTTTGCCAGG - Intronic
966845840 3:184129079-184129101 CTGTGGAAACAAATTTTACCTGG - Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968700694 4:2056589-2056611 CAGTGGAAACACCTTAGGCCAGG - Intergenic
969396970 4:6928216-6928238 CAGAGGGAACAGCTTGTGGCAGG + Intronic
970462430 4:16288450-16288472 CTGTGAAAACCACTAGTGCCAGG + Intergenic
977176497 4:93826662-93826684 CAGTGTAAGCAGCTAGTGCCTGG - Intergenic
977284439 4:95084979-95085001 CTATTGAAAGAGCTGGTGCCCGG + Intronic
978357642 4:107893776-107893798 GTGTGGACACATCTTGTCCCTGG + Intronic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
981732918 4:147918844-147918866 CTGAGGACACACGTTGTGCCTGG + Intronic
982020264 4:151196045-151196067 CTGTGGCAGCAGCTTATACCAGG - Intronic
985029415 4:185773730-185773752 CTGTGAAAATACCTTGTGCTTGG + Intronic
985587745 5:749695-749717 GTGTGGAAGCAGCATGTTCCAGG + Intronic
985602410 5:842162-842184 CTGTGGAAGCAGCATGTTCCAGG + Intronic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
987110475 5:14681373-14681395 CTGTGGAAAAAGCTTGGCCTGGG - Intronic
987353499 5:17042132-17042154 CTTTGGATTCATCTTGTGCCTGG + Intergenic
988651204 5:33153531-33153553 CCATGGAAACAGCTTTTCCCTGG - Intergenic
989494279 5:42093492-42093514 CTTTGGTAACTGCTTGTACCAGG - Intergenic
990518228 5:56550875-56550897 ATTTGGAAACAGGTGGTGCCAGG - Intronic
993598042 5:89884237-89884259 CTGTGGTAAGAGCATGTACCTGG + Intergenic
996471564 5:123867239-123867261 CAGAGGAAACAGTATGTGCCAGG + Intergenic
997249645 5:132378522-132378544 CTGAGGAAGAAGCGTGTGCCTGG + Intronic
997410234 5:133685443-133685465 CTGTAGACACAGCGTGTGCTAGG - Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998548663 5:143054634-143054656 ATGTGGAAACAGCTTCTGTGTGG + Intronic
999714732 5:154351580-154351602 CTGTGCACACACCTTGTTCCTGG + Intronic
1002345563 5:178545740-178545762 CTGTGCCTGCAGCTTGTGCCAGG - Intronic
1002598880 5:180342501-180342523 CTGTGGGGATAGCTTGGGCCTGG - Intronic
1003387244 6:5680023-5680045 ATATGGAAACAGCTATTGCCAGG + Intronic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1003581041 6:7341193-7341215 CAGTTGACACAGCTTGTGCTAGG + Intronic
1004177713 6:13354551-13354573 CTCTGGAAACAGCTTGTATGAGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006554910 6:34857791-34857813 CTGGGGAAACCTCTTTTGCCTGG + Exonic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007774568 6:44217737-44217759 TTGTGGATACAGCTGCTGCCAGG - Intergenic
1010802356 6:80191355-80191377 CAGTGGACACAGCTAGTGCTTGG + Intronic
1011044563 6:83067582-83067604 CTGTGGCAACAGCTAGCGCCGGG + Intergenic
1011765484 6:90615293-90615315 CTGTGGAATGATGTTGTGCCAGG + Intergenic
1013564312 6:111342104-111342126 CTTAGGAAACACCTTGGGCCTGG + Intronic
1017564478 6:155669283-155669305 CTATGCAAACAGCCTGTGGCTGG - Intergenic
1018098731 6:160417383-160417405 CTGGGGAAACAGCTTTTTCTTGG - Intronic
1018453883 6:163934916-163934938 CTCTGTAAACAGCTTGTCTCAGG - Intergenic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1018608047 6:165619850-165619872 AAGTGGAAGCAGCTTGTCCCCGG - Intronic
1019261055 7:82242-82264 CTGTGTGCACAGCCTGTGCCTGG + Intergenic
1019602836 7:1893811-1893833 CTGTGGAGTCACCTTGTCCCGGG - Intronic
1019767285 7:2861016-2861038 CTGTGGCACCAGCTCCTGCCTGG + Intergenic
1022351777 7:29572872-29572894 CTGGGGAAACAGGTTATGTCTGG + Intergenic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1026678866 7:72450361-72450383 CTGTGGACACTGTTTATGCCAGG - Intergenic
1026948911 7:74334347-74334369 CTGTTGAAACAACTGGTCCCTGG + Intronic
1027226945 7:76249586-76249608 GGGTGGGAACAGCCTGTGCCTGG + Intronic
1028381036 7:90198653-90198675 CTGTGGACACAGCTCCTGTCTGG + Intronic
1029519895 7:101053261-101053283 ATGGGGATACAGCTTGTCCCTGG + Intronic
1032982279 7:137297958-137297980 ATGTGGAACAAGCTTGTGACAGG - Intronic
1034752523 7:153584132-153584154 CTGTTGCAACAGCTTGTCTCTGG + Intergenic
1037274501 8:17163204-17163226 CTTTGGAAAGAGCTGCTGCCTGG + Intronic
1040931208 8:52737233-52737255 CTGTGGAAATAGCTCCTGACAGG - Intronic
1041384832 8:57289778-57289800 CTATGGAATGAGATTGTGCCGGG + Intergenic
1046033289 8:108808930-108808952 CTGAGAAGACAGCTTGAGCCTGG + Intergenic
1046792212 8:118334291-118334313 CTGTGTACATAGCTTATGCCAGG - Intronic
1048654192 8:136517232-136517254 CTGAGGAAACAGCATGAGTCTGG - Intergenic
1049169121 8:141147502-141147524 TTGTGGAAACAGCGTGTGCAAGG - Intronic
1049345053 8:142134278-142134300 CTGTGGCAGCAGCTTCTGTCTGG - Intergenic
1049382594 8:142324913-142324935 CTGTGGGAAGAGCCTGTGGCTGG + Intronic
1050802659 9:9635427-9635449 CTATAGAAACAGCTTCTGGCTGG + Intronic
1051820053 9:21154071-21154093 CTGTAGAAAAATCTTCTGCCAGG + Intergenic
1052255906 9:26456226-26456248 TTGTGGAAAGGGCATGTGCCTGG + Intergenic
1052878670 9:33586584-33586606 CTGTTGGAAAAGCTTCTGCCTGG - Intergenic
1053497307 9:38557625-38557647 CTGTTGGAAAAGCTTCTGCCTGG + Intronic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1054848131 9:69818753-69818775 CTGTGGAAAGAGCTTGGCCTTGG + Intergenic
1057396920 9:94688881-94688903 CTGAGGAAGCAGCCTGTGCCAGG + Intergenic
1057676790 9:97142107-97142129 CTGTTGGAAAAGCTTCTGCCTGG + Intergenic
1060725052 9:126000973-126000995 ATGTGGACTCAGGTTGTGCCAGG + Intergenic
1061273391 9:129556637-129556659 CTGAGAGAACAGCATGTGCCAGG + Intergenic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062209548 9:135356293-135356315 CTGTGAAAACACCTCGTGCCCGG - Intergenic
1062310181 9:135931235-135931257 CTGTGAACACAGCCTGTGTCTGG - Intergenic
1062580882 9:137228741-137228763 CTGTGGACACACCTTCTGCCAGG + Exonic
1062630562 9:137461355-137461377 CTGTGGGAACACGTGGTGCCCGG + Intronic
1187349106 X:18495592-18495614 CTCTGTAAACAGTTTGTCCCTGG - Intronic
1187659746 X:21529886-21529908 ATATGGAAACATCTTGTGGCAGG - Intronic
1189274790 X:39777921-39777943 CTGTGGTGCCAGCTTTTGCCAGG - Intergenic
1190833505 X:54080047-54080069 CTGTGGGAAAAGCTTGAGGCAGG + Intronic
1192196590 X:69032872-69032894 CTCTGGAGGCAGCTTGTGGCCGG + Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192623870 X:72707851-72707873 CTGTGTAATCATCATGTGCCAGG - Intronic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195708815 X:107757930-107757952 CTGGGGAAGCTGCTTGAGCCCGG + Intronic
1196228758 X:113196484-113196506 CTGTGGGAATAGCTTTTCCCTGG - Intergenic
1197544546 X:127808751-127808773 CTTTGGAAACACCTGGGGCCTGG + Intergenic