ID: 905910038

View in Genome Browser
Species Human (GRCh38)
Location 1:41647431-41647453
Sequence CTGTGGAAACAGCTTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905910038_905910041 24 Left 905910038 1:41647431-41647453 CCGGGCACAAGCTGTTTCCACAG 0: 1
1: 0
2: 3
3: 12
4: 216
Right 905910041 1:41647478-41647500 CAGAAATAACCCCACTGACATGG 0: 1
1: 1
2: 0
3: 28
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905910038 Original CRISPR CTGTGGAAACAGCTTGTGCC CGG (reversed) Intronic