ID: 905912488

View in Genome Browser
Species Human (GRCh38)
Location 1:41663638-41663660
Sequence GTTCCCTCCATTAAAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905912488_905912499 10 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912499 1:41663671-41663693 TAAGAGGCACTACATTCCTAGGG 0: 1
1: 0
2: 1
3: 10
4: 83
905912488_905912500 11 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912500 1:41663672-41663694 AAGAGGCACTACATTCCTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 91
905912488_905912502 22 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912502 1:41663683-41663705 CATTCCTAGGGGCAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 353
905912488_905912498 9 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912498 1:41663670-41663692 CTAAGAGGCACTACATTCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 94
905912488_905912492 -6 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912492 1:41663655-41663677 GGGAACCCCCACCTTCTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 97
905912488_905912501 19 Left 905912488 1:41663638-41663660 CCCCCAGCTTTAATGGAGGGAAC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 905912501 1:41663680-41663702 CTACATTCCTAGGGGCAGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905912488 Original CRISPR GTTCCCTCCATTAAAGCTGG GGG (reversed) Intronic
900092669 1:927238-927260 GTTCCCTCCTTTCAAGCAGCTGG + Intronic
904106125 1:28086117-28086139 GTTAATTCCATTAAAGCTGTAGG - Intronic
905912488 1:41663638-41663660 GTTCCCTCCATTAAAGCTGGGGG - Intronic
910696433 1:90022899-90022921 TTTCCCTGCATAAAAGTTGGAGG + Intronic
910752874 1:90653357-90653379 ATTCCCTCCATGAAAACTAGGGG + Intergenic
912836371 1:112999994-113000016 CTTCCCTCCCTGGAAGCTGGGGG + Intergenic
921870812 1:220137637-220137659 GTTTCCTCTATTACAGCTGGTGG - Intronic
1070107321 10:73446683-73446705 GTCCCCTCCATGTAAGCTGGTGG - Intronic
1073402477 10:103270019-103270041 ATTCCCGCCAGAAAAGCTGGTGG - Intergenic
1074507235 10:114082307-114082329 GTTCCATACATTAAGGCTGATGG + Intergenic
1076912711 10:133399684-133399706 GTCCCCTCCAAGAAAGATGGTGG - Intronic
1078604005 11:12758893-12758915 GTTTCCACCATTAACCCTGGAGG - Intronic
1080173643 11:29336418-29336440 GTTCCCTGCAATAATTCTGGAGG + Intergenic
1084460226 11:69292994-69293016 TTCCCCTCCACTACAGCTGGGGG + Intergenic
1089422892 11:118344799-118344821 GTTCCCTACTTCAGAGCTGGGGG + Intronic
1091323548 11:134667987-134668009 TTTCCCCCCATGAATGCTGGGGG + Intergenic
1091405516 12:206907-206929 CTTCCCTCCAATAAAGGAGGTGG + Intronic
1092961368 12:13599340-13599362 CTTGCCACCATTACAGCTGGAGG + Intronic
1094472886 12:30819716-30819738 GTCCCCTCCATGGCAGCTGGAGG + Intergenic
1095965027 12:47861346-47861368 GTTACCTCCATAGAAGATGGAGG - Intronic
1097920080 12:65062542-65062564 GGTCCCTCCATTAAAGCAGGTGG + Exonic
1101430639 12:104624040-104624062 CTTCCCTCCATCAAGGCTGCAGG - Intronic
1105255916 13:18744118-18744140 GTTCCCTCCAGGAATCCTGGTGG - Intergenic
1113150778 13:107261374-107261396 GTTCCCTCGATGAATGCTGTTGG + Intronic
1116997866 14:51342655-51342677 GTTCACTTCCTTGAAGCTGGAGG - Intergenic
1117728208 14:58695044-58695066 CTTCCCTCCCTTGAGGCTGGGGG - Intergenic
1119481524 14:74961150-74961172 GGTCCCTCCATTAAAGCTTAGGG - Intergenic
1120859050 14:89238083-89238105 GTTTCCTCCTTTAAAGGTAGAGG - Intronic
1121349563 14:93162562-93162584 GTTTCTTCCTTTAAAGCAGGTGG + Intergenic
1121511811 14:94518086-94518108 GTTCCCTGCATTTAAGCAGGAGG + Intergenic
1127630946 15:60827166-60827188 GTCCCCTCCATTACAGCTATGGG + Intronic
1128074758 15:64819122-64819144 GCTCCTTCAACTAAAGCTGGGGG - Exonic
1131523352 15:93133547-93133569 GTTCCCACCATGAAGGGTGGGGG - Intergenic
1132589069 16:718464-718486 GTTTCCCCCTTGAAAGCTGGGGG - Exonic
1132783499 16:1641788-1641810 GTTCCCTGCTTTACAGCTTGGGG + Intronic
1135860401 16:26050961-26050983 GTTCCCTCCATTCCAGCTCCAGG - Intronic
1137386267 16:48045366-48045388 GTACCCTCTATAAAAGCGGGCGG - Intergenic
1138187633 16:54988564-54988586 GTTCCCTGCATTATAGCTTAGGG + Intergenic
1140940555 16:79718001-79718023 TTTCCCTCCATTTAAGCTTGTGG - Intergenic
1141003617 16:80331450-80331472 GTTCTCTTCATTGAAGCAGGTGG - Intergenic
1141516382 16:84547979-84548001 GATCCCTCCCTGACAGCTGGTGG + Intronic
1141911940 16:87066391-87066413 GTTGTCTCCATTAAAGCTCTAGG - Intergenic
1142953941 17:3507370-3507392 GTTTCTTCCATTTAAGATGGTGG - Intronic
1144070267 17:11665410-11665432 GTTTCTTCCATTTAACCTGGCGG - Intronic
1146123062 17:30211651-30211673 GTGCCCTCCATTAACCCTGGGGG + Intronic
1147403675 17:40195551-40195573 GTTCACTCTGTTAAAGCTGCAGG - Exonic
1147886094 17:43685319-43685341 GTTCTCTTCCATAAAGCTGGGGG - Intergenic
1152860441 17:82693448-82693470 GCTCCCACCAGCAAAGCTGGAGG - Intronic
1154435116 18:14336571-14336593 GTTCCCTCCAGGAATCCTGGTGG + Intergenic
1157517837 18:48323519-48323541 ACTCCCTCCCTTAAAGCTGAGGG + Intronic
1158444037 18:57503166-57503188 ATTCCCACCAGTAACGCTGGAGG + Intergenic
1158712530 18:59849949-59849971 TTTCCCCCCTTTAAAGATGGAGG - Intergenic
1160443496 18:78911301-78911323 GTGCTCTCCATTTCAGCTGGTGG - Intergenic
1162126161 19:8500450-8500472 GTTCCCCCCATGGCAGCTGGAGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
926178704 2:10620535-10620557 GTTCCCCCAAATAAAGCTGAAGG + Intronic
927680991 2:25138878-25138900 GTCACCTTCATTAAAGCTGAAGG - Intronic
933710548 2:85322459-85322481 GTTCCCTTTATTTATGCTGGTGG - Exonic
934490926 2:94761735-94761757 GTTCCCTCCAGAAATCCTGGTGG - Intergenic
944310287 2:198225498-198225520 CTGCCCTCCACTAAGGCTGGGGG + Intronic
947398569 2:229711198-229711220 GTTCCCTCCTTTGGTGCTGGTGG - Intronic
948492804 2:238324393-238324415 GTTCCCTCCATTGCACCTGAAGG + Intronic
948672326 2:239576406-239576428 GTCCCCTCCCTTTAAGCTTGGGG - Intergenic
1170893722 20:20396274-20396296 GAGGCCTCCATTAAGGCTGGCGG + Intronic
1171136562 20:22700252-22700274 GTTCTCTCCAGTAAAGAGGGAGG - Intergenic
1172186570 20:33034756-33034778 GTTCCCTCCCATGAAGCTGGAGG - Exonic
1175247559 20:57590997-57591019 GTCCCCTCCACTCCAGCTGGTGG - Intergenic
1176841918 21:13849131-13849153 GTTCCCTCCAGGAATCCTGGTGG - Intergenic
1184800286 22:46754803-46754825 GTTCCCTTCACTCTAGCTGGGGG + Intergenic
950013285 3:9738936-9738958 TTTCCCTCCCTTAAAGATGATGG - Intronic
950256098 3:11507588-11507610 GTTCCCTCCATTATAAGTGAAGG + Intronic
954122497 3:48507705-48507727 CAGCCCTCCATCAAAGCTGGTGG - Intergenic
956751564 3:72347863-72347885 TTTCCCTCCAAGAAAGCTGAAGG + Intergenic
960087607 3:113607646-113607668 GTTTCCTCAAATAAAGCTGCTGG + Intronic
960877123 3:122308217-122308239 CTTTCCCCCATTAAAGCTAGTGG - Intergenic
962053748 3:131846977-131846999 CTTCCCTCCCTTCAAGCTGTGGG - Intronic
969345498 4:6567348-6567370 GTTCCCTCCATTCCAGCTACAGG + Intergenic
969601693 4:8180101-8180123 GTTTCCAGCAATAAAGCTGGTGG - Intergenic
972621522 4:40751614-40751636 GCTCCTCCCATTAAAGCTAGTGG - Intronic
974334762 4:60527798-60527820 ATTCCCTCCATTAAAGGAGGGGG + Intergenic
982455254 4:155602258-155602280 GATCGCTCCTTTAAATCTGGAGG - Intergenic
986299813 5:6469134-6469156 CTGCCCTCCATCAATGCTGGTGG - Intronic
986412681 5:7496720-7496742 AATCCCTCCATTAATGCTAGTGG - Intronic
991524712 5:67543655-67543677 GTTCCATGGATTAAAGCTGTGGG + Intergenic
997375229 5:133393005-133393027 GTTCCTTGCATAAAACCTGGAGG + Intronic
997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG + Intergenic
997855776 5:137371277-137371299 CTTCCCTCCACTTAAACTGGTGG + Intronic
1003036589 6:2645300-2645322 GTTCCCGCCAGGCAAGCTGGGGG + Intergenic
1003143301 6:3489524-3489546 TTTCCCACCATTGAAACTGGTGG + Intergenic
1014547465 6:122749250-122749272 GTCTCCTCCCTTAAACCTGGTGG + Intergenic
1022770415 7:33465989-33466011 GTACACTTCAATAAAGCTGGGGG - Intronic
1029042143 7:97587348-97587370 GTTCCCTCCATTGCTGCAGGAGG + Intergenic
1033756141 7:144399370-144399392 GTTCCCACCTTCAGAGCTGGGGG - Intronic
1034475779 7:151280906-151280928 GTTGCCTCCAGTGAGGCTGGAGG + Intergenic
1038152865 8:24957924-24957946 AATCCCTCCATGAAACCTGGGGG - Intergenic
1038235989 8:25755661-25755683 GTTCCCTCCAATGAAGCAAGAGG - Intergenic
1039119596 8:34130848-34130870 TTGCCCTCCCTTAGAGCTGGTGG + Intergenic
1041388664 8:57330063-57330085 CTTTCCTCCATCCAAGCTGGTGG - Intergenic
1044759923 8:95507262-95507284 GTTGCCTCCATTGCAGATGGAGG - Intergenic
1045124288 8:99072315-99072337 GTTCCTTCCCTTAAAGGTAGTGG + Intronic
1049439352 8:142602138-142602160 TTGCCCTCCCTTCAAGCTGGAGG + Intergenic
1050474362 9:6024298-6024320 GTTGCCACCACTAAAGCTGAGGG - Intergenic
1052038798 9:23714447-23714469 GTTCCCTCCATCCAGGCTGCAGG - Intronic
1053667065 9:40323953-40323975 GTTCCCTCCAGGAATCCTGGTGG + Intronic
1053916655 9:42949062-42949084 GTTCCCTCCAGGAATCCTGGTGG + Intergenic
1054378212 9:64463981-64464003 GTTCCCTCCAGGAATCCTGGTGG + Intergenic
1054517545 9:66052330-66052352 GTTCCCTCCAGGAATCCTGGTGG - Intergenic
1054986207 9:71264414-71264436 TTACACTTCATTAAAGCTGGGGG + Intronic
1056524371 9:87429275-87429297 GCTCCCTCCAATAATGCAGGTGG - Intergenic
1057542577 9:95989257-95989279 GTTCCCTCCCTGAAAGTTGGGGG + Intronic
1058155169 9:101506758-101506780 TTAACATCCATTAAAGCTGGAGG + Intronic
1058876920 9:109252474-109252496 TTTCCCTCCACTAAAGCAGCTGG + Intronic
1059327676 9:113514180-113514202 GCTGCCTCCATCATAGCTGGTGG + Intronic
1061781435 9:132998842-132998864 GTCCCCTCCCTCAAAGCTGCAGG + Intergenic
1186109305 X:6239006-6239028 GTTCCCTCCTTCAAAGATGATGG + Intergenic
1187750119 X:22453836-22453858 GTTCACTCCATTACACATGGAGG + Intergenic
1191892434 X:65957673-65957695 CTTCCCTCCAGGCAAGCTGGGGG - Intergenic
1196179018 X:112670371-112670393 GTTCCCTGCACTAAAGTTAGGGG + Intronic
1197171080 X:123435130-123435152 TTTCCCTCCAGGGAAGCTGGTGG + Intronic