ID: 905913371

View in Genome Browser
Species Human (GRCh38)
Location 1:41669012-41669034
Sequence CTGGAGTTCCTGAGGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905913371_905913376 9 Left 905913371 1:41669012-41669034 CCATGATCCCTCAGGAACTCCAG 0: 1
1: 0
2: 0
3: 28
4: 205
Right 905913376 1:41669044-41669066 CCAGTCAGCCATGTACCTTCCGG 0: 1
1: 0
2: 1
3: 9
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905913371 Original CRISPR CTGGAGTTCCTGAGGGATCA TGG (reversed) Intronic
905370252 1:37479241-37479263 CTGGATTTCCTGAGGGATGGGGG - Intronic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
907283036 1:53363179-53363201 CTTGGGTGCCTGAGGGATGAAGG - Intergenic
907716285 1:56929346-56929368 CATGAGTTCTTGAGGGCTCAGGG + Exonic
908656600 1:66395018-66395040 AGGGAGTTCCTGAGGCTTCAGGG + Intergenic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
910487057 1:87726480-87726502 CTGGAGTTTATGAGGGATAATGG + Intergenic
912591666 1:110827378-110827400 CCAGAGTTTCAGAGGGATCATGG - Intergenic
912957243 1:114164189-114164211 CTGGGATTCCTGAGGGTCCAGGG - Intergenic
914831446 1:151173767-151173789 CTTCAGTTCTTGAGAGATCAGGG - Intronic
914963941 1:152236296-152236318 TAGGAGTTCCTGAGGGCACAGGG - Intergenic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918054145 1:181004269-181004291 CTGGAGATTCCAAGGGATCAAGG - Intronic
921275232 1:213512565-213512587 CTGGAGTTCCAGCAGGATTAGGG + Intergenic
922542874 1:226432613-226432635 CTGGAATTGCACAGGGATCATGG + Intergenic
1062911860 10:1216739-1216761 CCCGAGTCCCTGAGGGAGCAAGG - Intronic
1063577906 10:7278519-7278541 CTGGAGCTCCTGATGGGACAGGG + Intronic
1063589278 10:7380076-7380098 CTGGAGTTCCTGAGCTTTCAGGG - Intronic
1064203342 10:13302288-13302310 CCGGAGCTGCTGAGGGATCCCGG - Intronic
1064430806 10:15268328-15268350 CTGCAGTGCCTGAGGGGACATGG + Intronic
1067067706 10:43113016-43113038 CTGAAGTGCCTGTGGGATCCAGG - Intronic
1067852051 10:49760479-49760501 CAGGAGCTCCTGAAGCATCAGGG + Intronic
1069621578 10:69840704-69840726 ATGGGATTCCTGAGGGATCTGGG + Intronic
1069960229 10:72075110-72075132 CAGGAGCTCCTCAGGGTTCAGGG + Intronic
1070149877 10:73799160-73799182 CTGTAGTGCCAGTGGGATCAGGG + Exonic
1070795829 10:79215759-79215781 GGGGAGTTCCTGAGGGCCCAGGG + Intronic
1071248639 10:83791909-83791931 CTGGAGGTCCAGTGGGATCGGGG + Intergenic
1071454698 10:85836981-85837003 GTGGAGTTGCTGTGGGCTCAGGG - Intronic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073641982 10:105262250-105262272 CTGGAAATCCTGGGGGATAAGGG - Intronic
1075975149 10:126688023-126688045 CTGAAGTTCCGGTGGGGTCAGGG - Intergenic
1076393586 10:130121844-130121866 CTGGACTTGCTGAGGGAGCTCGG + Intergenic
1078603401 11:12753620-12753642 TTGGAGTTCCTGTAGGATGAAGG + Intronic
1078888199 11:15526937-15526959 CTGGAGTTCTTTGGGAATCATGG - Intergenic
1082803028 11:57427995-57428017 CTGGAGTTCCTGGGCCCTCAGGG - Intergenic
1084755812 11:71237940-71237962 CTGGAGTTCCCATGGGATAAGGG + Intronic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089089857 11:115862500-115862522 CTGGGGTTCCTGTGGCATCATGG - Intergenic
1089457236 11:118632739-118632761 CTGCAGATCCTGAAGGCTCAAGG - Intronic
1089582342 11:119489294-119489316 CTGGGGGTCCTGATGGACCAGGG + Intergenic
1089605498 11:119638962-119638984 CTGGGGCTCCTCAGGGGTCATGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1098700231 12:73614629-73614651 TTGTAATTCCTGAGGGATCATGG + Intergenic
1100089891 12:90955536-90955558 TTGGAGGGCCTAAGGGATCATGG + Intergenic
1100553887 12:95672991-95673013 ATGGAGTTCCTGGGGGATGAAGG + Intronic
1102944605 12:116974952-116974974 TTGGAGCTCCTGAGGGCTAAAGG + Intronic
1102952263 12:117038764-117038786 CTGGAGTGCAGGCGGGATCACGG - Intergenic
1104809348 12:131611183-131611205 CTGGAGTGCCTGTGGAATGAGGG + Intergenic
1105867131 13:24471023-24471045 CTGGAGTTTCTCAGCGATCTGGG + Intronic
1106802466 13:33270432-33270454 CTAGAGTGCCTGAGGGATGCTGG - Intronic
1106920948 13:34562460-34562482 CTGGAGTTCCTGCATGAGCAAGG - Intergenic
1107377552 13:39820822-39820844 CTGGAATTCCAGAGGCATCTAGG - Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113344871 13:109467476-109467498 CTTGAGTCCCTTAGGGATGATGG + Intergenic
1113617920 13:111694099-111694121 GTGGAGTTTCTGTGGGACCATGG - Intergenic
1113623453 13:111779360-111779382 GTGGAGTTTCTGTGGGACCATGG - Intergenic
1113628721 13:111865487-111865509 CTTGTGTTCCTGAGGGATTGGGG + Intergenic
1114435766 14:22706575-22706597 CTGGATTTCATCAGGGATCAAGG + Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1118352411 14:64982620-64982642 CTGGAGTTCAGGAGAGATCCAGG + Intronic
1118364286 14:65081190-65081212 TTGGACTTGCTGAGGGATCAGGG - Intronic
1119168586 14:72515773-72515795 CTGCGGTTCCTGAGGGCTCAGGG - Intronic
1121118224 14:91358393-91358415 CTGGAGTAGGTGAGGGGTCAAGG - Intronic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1123014167 14:105365652-105365674 CTGGGGTCCCGGAGGAATCAAGG - Intronic
1124140551 15:27073322-27073344 CTGGAGGTCCTGGAGGACCATGG - Intronic
1125026235 15:35032257-35032279 CTGGAGTTCCTCAGGTGACATGG - Intergenic
1125210825 15:37213301-37213323 CTGAAGTTCATGAGGGATATTGG - Intergenic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128254233 15:66185292-66185314 CAGGAGTTCCTGCTGGAACAGGG - Intronic
1129190618 15:73935516-73935538 CTGGAGTAACTGAAGCATCAAGG + Intronic
1130398846 15:83530176-83530198 CTGCAGTTGCTTAGGTATCAGGG + Intronic
1130447373 15:84015764-84015786 CTGGGGTTTCTCAGGGAGCATGG - Intronic
1131057441 15:89383974-89383996 CTGGAGTTTCTGAGGGGGAAAGG - Intergenic
1132298642 15:100763162-100763184 CTGGACTTCCCCAGGGATAAAGG - Intergenic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1132918654 16:2369997-2370019 CTGGTGTTTCAGACGGATCATGG - Intergenic
1134132267 16:11657791-11657813 CTGGAGTCCCTGAGTGAGAAAGG - Intergenic
1136415430 16:30100337-30100359 CTGAATTTCCTAAGGGAACAAGG + Intergenic
1137756389 16:50905777-50905799 CTGGAGTGCATGTGTGATCATGG - Intergenic
1138273190 16:55710636-55710658 CTGGAGTTCCAGGAGGACCAAGG + Intergenic
1140425758 16:74859911-74859933 CTGGAGTTCATGGTGGATGAAGG - Intergenic
1140548413 16:75835464-75835486 CTGGAGTTCCTAGGGGACCTAGG + Intergenic
1140712519 16:77691573-77691595 CTGTAGTTCCTGAAGGACCATGG - Intergenic
1142029267 16:87830500-87830522 CTGGAATTCCACAGGGACCAGGG - Exonic
1142122663 16:88394730-88394752 GTGCAGTGCCTGAGGGAACAGGG + Intergenic
1143323238 17:6081270-6081292 CTGGAGTTCCACATGGCTCAAGG + Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144075031 17:11709870-11709892 CAGGAGTTCCTGAGAAATTAAGG - Intronic
1144237121 17:13272330-13272352 CTGGAATTACTGTGGGCTCATGG + Intergenic
1144415462 17:15042319-15042341 CAGGGGTTCCTGGAGGATCATGG - Intergenic
1144623633 17:16833472-16833494 CTGGAGATCCCGGGGGCTCAAGG - Intergenic
1144882796 17:18439244-18439266 CTGGAGATCCCGGGGGCTCAAGG + Intergenic
1145149435 17:20505142-20505164 CTGGAGATCCCGGGGGCTCAAGG - Intergenic
1147577965 17:41613404-41613426 CTGGAGATCCCGGGGGCTCAAGG - Intronic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1148105936 17:45118880-45118902 CTGGAGTTCCTGGAGGACCAGGG - Exonic
1148663863 17:49360887-49360909 CAGGTGTTCCTGAGGGTCCACGG + Intronic
1149914681 17:60598319-60598341 CTTGAGTTTCTGAGGGAGGAAGG + Intergenic
1152531612 17:80922432-80922454 CTGAGGCTCCTGAGGGGTCAGGG - Intronic
1154106519 18:11528131-11528153 CTGCAGACCCTGAGGGCTCAGGG - Intergenic
1154342928 18:13519338-13519360 CTGGTGTTCCGGAGGGAGCCGGG + Intronic
1158939533 18:62394166-62394188 AGGGTGTTCCTGAGGGTTCAGGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160143807 18:76348233-76348255 CTGGAGTTCTTGGGGGTTCAGGG - Intergenic
1161542592 19:4861114-4861136 TTGGAGGGCCTGAGGGAGCAGGG - Intronic
1162968840 19:14168144-14168166 CAGAAGTTCCTGAGGGGCCAGGG - Intronic
1163189609 19:15666957-15666979 CTGGGCTTCCTGAAGGATAAGGG - Intergenic
1165007189 19:32816902-32816924 CTGGAACTCCTGAGTCATCAGGG + Intronic
1165472464 19:36011241-36011263 GTGGAGGTCCTGAGGGATTAGGG - Intronic
1167583506 19:50359964-50359986 CTGGAGTTCCTACGGGGTAATGG + Intronic
1168295141 19:55374497-55374519 CCGGGATTCCTCAGGGATCAAGG - Intergenic
925211862 2:2056257-2056279 CTGGAGAGCCTGAGGGACCCAGG - Intronic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
929592799 2:43158034-43158056 CCCGAGTTCCTGATGGCTCATGG - Intergenic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
932576046 2:72962993-72963015 CTGGACTTCCTTAGGGGTCGTGG + Intronic
934574135 2:95389845-95389867 TTGGTGTTCCTGAGGGTTCGGGG - Intergenic
937732367 2:125248964-125248986 CTGGAATTCCTCAGGGCACACGG - Intergenic
937980037 2:127609379-127609401 CTCCAGCACCTGAGGGATCAGGG + Intronic
941167811 2:162102174-162102196 TAGGAGTTCCTGAGGGCACAGGG + Intergenic
941439625 2:165517940-165517962 CTGGAGTTCCTGAGATCTCAAGG + Exonic
945764624 2:213959685-213959707 CTGGAATTCCAAAGGCATCAGGG - Intronic
1168771177 20:417880-417902 CTGCAGCTCCTGAGGGTTGAGGG - Exonic
1169560925 20:6799924-6799946 CTGGATTTACTGAGGGATGTGGG + Intergenic
1169745809 20:8941561-8941583 ATGGAGTTGCTAAGGGATCAAGG + Intronic
1170152614 20:13241186-13241208 CTGCAGTTGCAGAGGCATCATGG + Intronic
1171286466 20:23943079-23943101 TTTGAGTTCCTGAGTGATCTGGG + Intergenic
1172274675 20:33673265-33673287 CTGGAGTTCATGGGGGCTCTCGG - Intronic
1173146099 20:40525732-40525754 CTTGAGATCCTGAGAGATCAGGG + Intergenic
1173584878 20:44174946-44174968 CTGGAGTGCAGGAGGGATCTTGG - Intronic
1173751613 20:45481073-45481095 GTGGCCTTCCTGAGGGGTCATGG - Intronic
1175132079 20:56796866-56796888 CTGCAGTTCCTAAGGGGGCAAGG - Intergenic
1175998611 20:62822134-62822156 CGGGAGGTCCTGGGGGACCAGGG - Exonic
1176163081 20:63658411-63658433 GTTGAGTTCCTGAGGGACCCCGG + Exonic
1176718757 21:10376845-10376867 TTGGAGTTCCTGTGGGTTCCGGG - Intergenic
1178855940 21:36250477-36250499 CTGGGGTTCCTGAGGCGGCATGG + Intronic
1182503618 22:30766341-30766363 CTTGAGCTGCTGAGAGATCAAGG - Intronic
1183456609 22:37926443-37926465 CTGCAGTTCCTGAGCGACCTGGG + Intronic
1183523732 22:38311435-38311457 CTGGATTTTCTGAGTGATCTTGG + Intronic
1183588614 22:38767403-38767425 CTCGTGTTCTTGAGGGATCCAGG - Intronic
1183717109 22:39539970-39539992 CTGGCTTCCCAGAGGGATCAAGG - Intergenic
949856741 3:8468820-8468842 CTGAAGTGCCTGAGAGACCAAGG - Intergenic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
953244072 3:41175006-41175028 CTGGAGATCCTTAGGGGTCTAGG - Intergenic
953367007 3:42353623-42353645 CAGAAGTTCCTGAGAGAACAGGG + Intergenic
953435622 3:42875020-42875042 CTTCAGTTTCTGAGGGAGCAGGG - Exonic
953669666 3:44951921-44951943 CTGGTGTTCCTCAGGGTTCAGGG + Intronic
954414152 3:50384803-50384825 ATGGAGTTCCTCTGGGACCAGGG + Intronic
954447189 3:50553132-50553154 CTGAGGAGCCTGAGGGATCAGGG + Intergenic
954451008 3:50571744-50571766 CTGTAGTTGCTGAGAGGTCAAGG - Exonic
954709158 3:52496427-52496449 CTGGACTGCCTGTGGGATCCTGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
960495067 3:118363306-118363328 CTGCACTGCCTGAGGAATCATGG - Intergenic
961793460 3:129393069-129393091 CAGGTGTTCCTGGGGGATCCTGG - Intergenic
961807457 3:129499687-129499709 CAGGTGTTCCTGGGGGATCCTGG - Intronic
962033052 3:131621590-131621612 CTGCAGTATCTGAGGGATAATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962670832 3:137707031-137707053 CTGGAGTTCCTAAGGGGGCCAGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968445385 4:649808-649830 CAGGAGGTCCTGAGGGGCCAGGG - Intronic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
972343086 4:38169787-38169809 CCAGAGATCCTGAGGGATAAGGG - Intergenic
974237332 4:59199046-59199068 CTGGAGTGCAGGAGTGATCATGG + Intergenic
975304869 4:72837965-72837987 CTGATGTTCGTCAGGGATCATGG + Intergenic
977846555 4:101773811-101773833 CTGGAGGGTCTGAGGGGTCAGGG + Intronic
978069936 4:104454609-104454631 CTGCATGTTCTGAGGGATCAGGG - Intergenic
978914868 4:114112178-114112200 CAGGACTTCCTGAGGCTTCACGG - Intergenic
981549626 4:145930595-145930617 CTGGAGTTCTTAAGTGACCAGGG - Intronic
983814124 4:172101957-172101979 CTTGAGTTTCTGAGAAATCATGG + Intronic
983870734 4:172822449-172822471 CTGGAGTTCCAGAGAGACCATGG - Intronic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
985841156 5:2306948-2306970 CTGCAGTTCCTGATGGGTGAAGG - Intergenic
986140573 5:5026158-5026180 CTGGACTTCCTGAGTCAACAGGG - Intergenic
986632216 5:9784680-9784702 CTGGAGCTTCTGAGGGAGCGGGG - Intergenic
988483169 5:31646324-31646346 CTGGAATTCCTCAGGGGTAAGGG - Intronic
989213922 5:38884406-38884428 CTGGAATTACTTCGGGATCATGG + Intronic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
996059475 5:119017105-119017127 CTGGAGTAACTGAGTGATAATGG + Intergenic
996746525 5:126851065-126851087 CTGGTGTTCCTGAGTGGTCCTGG + Intergenic
999714571 5:154349864-154349886 CTGGAATTCAGGAGGGACCAGGG - Intronic
1000339878 5:160268864-160268886 CTTGATTTCCTGAGGGAGAAAGG - Intronic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1006441277 6:34055239-34055261 CTGGTGTTCCTGAGAGAGAAGGG - Intronic
1007291056 6:40787068-40787090 GTGGGGCTCCTGAGGAATCATGG - Intergenic
1010112688 6:72259037-72259059 CTGGACTTCGGGAGGCATCATGG - Exonic
1013701643 6:112777409-112777431 CTGGAGAGCCGGAGGGCTCATGG + Intergenic
1015132670 6:129831678-129831700 TTGGAATTCCTGAGGGAACTAGG - Intronic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016655890 6:146517896-146517918 TTGGTGTTCCTCAGGGATCCTGG - Intergenic
1019411317 7:908022-908044 CTGAAGTCACTGAGGGGTCACGG - Intronic
1022624436 7:32020093-32020115 CTTGAGAGCCTGAGGGATCCCGG - Intronic
1024673184 7:51615269-51615291 CTGGCATTCCTGAGAGCTCATGG + Intergenic
1028475081 7:91244565-91244587 CAGGAGATCCTGAGGCAGCAGGG - Intergenic
1029603373 7:101583185-101583207 CTGGGGTCCCTCAGGGATGAGGG + Intergenic
1030987242 7:116256310-116256332 CAGGAATTACTGAGGGATAAGGG - Intronic
1031979410 7:128115150-128115172 CTGGAGTTCAGGAGGAAACATGG - Intergenic
1034400214 7:150857119-150857141 CTGGAGCTCCTCGTGGATCATGG + Exonic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1037587995 8:20291170-20291192 ATGGAGATCCAGAGTGATCAAGG + Intronic
1037952688 8:23029086-23029108 CAGGTCTTACTGAGGGATCAGGG + Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1040914489 8:52555221-52555243 CTGGAGTCCCGGTGGGATCATGG + Intronic
1043147032 8:76672382-76672404 CTGGAGTTCCAAAAGGATAAAGG - Intergenic
1046098487 8:109587704-109587726 CTGGAGTTCCTGAGAGCTCCTGG - Intronic
1046237418 8:111443856-111443878 CTGGAGTTACTCATGGATCCAGG - Intergenic
1046859366 8:119072704-119072726 CTGGAGTTCCACAGGGACCAAGG - Intronic
1048049897 8:130806835-130806857 CTGCTCTTCCTGAGGGGTCACGG - Intronic
1048590741 8:135818479-135818501 CTGGAGGTCCTGAGAGATGAGGG + Intergenic
1049071679 8:140360049-140360071 CTGGACTTCTTGTCGGATCAGGG - Exonic
1049342225 8:142119269-142119291 CTGGAGTTCCGGAAGCAGCAGGG - Intergenic
1051971552 9:22893791-22893813 CTGGAGTTGATGATGGATGAAGG - Intergenic
1052108124 9:24545391-24545413 CTTGAGTTCCTGAGAGTCCAGGG - Intronic
1055023504 9:71694950-71694972 CTAGAGTGACTGAGGGACCATGG - Intronic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1061396566 9:130346926-130346948 CTAGGGTCCCTGAGGGACCAAGG - Intronic
1186053851 X:5628052-5628074 CAGGATCTCCTGAGGTATCACGG + Intergenic
1187186658 X:16993168-16993190 CTGGAGTTGGTGATGGTTCACGG + Intronic
1189716265 X:43869974-43869996 ATGGAGTTCTTGATGGATAAGGG - Intronic
1192833002 X:74769724-74769746 CTGGAGTTACTGAAAGATGAGGG + Intronic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1196173228 X:112612745-112612767 CTGGGCTTCCTCTGGGATCAGGG - Intergenic
1196808364 X:119608485-119608507 CTGGAGTGCCTGCAGGATCAAGG - Intergenic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1198127996 X:133666249-133666271 ATGGAGTCACTGTGGGATCAGGG - Intronic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic