ID: 905914419

View in Genome Browser
Species Human (GRCh38)
Location 1:41675047-41675069
Sequence CAGGGACACCCATGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905914419_905914432 14 Left 905914419 1:41675047-41675069 CCATCCTCCCATGGGTGTCCCTG 0: 1
1: 0
2: 2
3: 36
4: 336
Right 905914432 1:41675084-41675106 CCCCAAATGTCCTTGACTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905914419 Original CRISPR CAGGGACACCCATGGGAGGA TGG (reversed) Intronic
900137861 1:1126083-1126105 CAGGGACCCCCCGGGAAGGACGG + Intergenic
900166395 1:1245781-1245803 CAGAGACGCCCTCGGGAGGAGGG + Intronic
900530182 1:3149212-3149234 CAGGGGCAGCCACTGGAGGATGG + Intronic
900565856 1:3331525-3331547 AAGGGACACACATGGGACGGGGG + Intronic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
900644958 1:3704816-3704838 CAGCTACACACATGGGAGGTTGG - Intronic
901420941 1:9150689-9150711 CAACGACACCAATGGGAGGAGGG + Intergenic
901497288 1:9629349-9629371 CAGGAACCCCCAGGGGAGGACGG + Intergenic
904603072 1:31684172-31684194 CAGTGACAGACATGGCAGGACGG - Exonic
904930950 1:34087103-34087125 CAGGGCCACCGTTTGGAGGATGG - Intronic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905239971 1:36575196-36575218 CAAGGACAGCCAGGGGTGGAAGG + Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
906707518 1:47905544-47905566 GAGGCACAGCCATGGGAGGCTGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
909656893 1:78042783-78042805 CAATGACCCCCATGGGAGAATGG - Intronic
909878982 1:80848536-80848558 CAAGGACACCCATGGGACCTGGG - Intergenic
912504468 1:110146660-110146682 CAGGGAAGTCCATGGGGGGAAGG + Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915580500 1:156809975-156809997 CAGGGAGACCCAGGGTTGGATGG + Intronic
916423744 1:164661277-164661299 CAGACACACCCATGGGAGAGAGG - Intronic
916880880 1:169018599-169018621 CTGGGACAGCCCTGGGAGTAGGG - Intergenic
919761620 1:201101744-201101766 CTTGGAGCCCCATGGGAGGATGG + Intronic
919767054 1:201134275-201134297 CAGGGACATCCAGGGGAGCCCGG - Intergenic
919815579 1:201436496-201436518 CAAGGACACACATGGGAAGGAGG + Intergenic
919930078 1:202215353-202215375 CAGGGATTTCCATGCGAGGAGGG + Intronic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922764711 1:228150843-228150865 CAGGGACAGCCTTAGGAGGCTGG + Intronic
922932746 1:229403118-229403140 CAGGGACCACCCTGGGAGCATGG - Intergenic
923000659 1:230004086-230004108 CAGAGACACCTAAGGGAGAATGG - Intergenic
1063531775 10:6840136-6840158 TTGGGACACCCAAGGCAGGAGGG - Intergenic
1064495173 10:15901985-15902007 CAGGGAGACCCATGGCAGAGCGG + Intergenic
1064799724 10:19055664-19055686 CAGGAACACACAAGGGAGAAAGG - Intronic
1066047529 10:31606347-31606369 CAGTGACAGCCATGGGAGAAAGG - Intergenic
1067470951 10:46537246-46537268 CAGGGATACCCTTGGGAGTTTGG + Intergenic
1068320016 10:55400571-55400593 CAGGAATAACCATGGGAGCACGG - Intronic
1071312195 10:84353282-84353304 CAGGAACACCCATGGAAGACAGG - Intronic
1071932757 10:90491682-90491704 CAGGGACACACATGTGTGGCAGG - Intergenic
1075209305 10:120477691-120477713 CAGTGAGCCCCTTGGGAGGAGGG + Intronic
1075383155 10:122035099-122035121 CAGGGACACCCGTAGGAGCCTGG - Intronic
1075509700 10:123061317-123061339 CAGGGACATCCAGGGCAGCATGG + Intergenic
1076269116 10:129135138-129135160 CAGGCTCGCCCATGGGAGGGTGG - Intergenic
1076628260 10:131834830-131834852 CAGGGTCACCCATGGGGGTGTGG - Intergenic
1076693728 10:132237045-132237067 CAGGGACCCACACGGGTGGATGG + Intronic
1077363261 11:2150481-2150503 CATGCCCTCCCATGGGAGGAGGG + Intronic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1079341606 11:19616421-19616443 TATGGACACCCTTGGGAGAAAGG - Intronic
1079996925 11:27304928-27304950 CACTGACAAGCATGGGAGGAAGG + Intergenic
1081638988 11:44740055-44740077 CAGAGACACCTATGGTAGGGTGG + Intronic
1083633871 11:64109666-64109688 GAGGGCCTCCCATGGGAGGCTGG + Intronic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1084118839 11:67057126-67057148 CTGGGACACCCCTCGGAGGCCGG - Intronic
1084331099 11:68431160-68431182 CAGGAACTCCCACGGGAGAAAGG - Intronic
1084653326 11:70501545-70501567 CAGGGACACCTTTGGAAAGAGGG - Intronic
1085040338 11:73323130-73323152 CAGGGACCCCCCTGAGAGGCAGG - Intronic
1085637838 11:78172045-78172067 CACAGGCACCCATGGGAGGTGGG - Exonic
1087128418 11:94648195-94648217 TAGAAACACCCATGGGAGGATGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1090037846 11:123264242-123264264 CAGGGACACTAATGGGAGACAGG - Intergenic
1090388780 11:126373734-126373756 CAGGGTCATGCATGGGAGGATGG - Intronic
1090392026 11:126394952-126394974 CAGGGTCATGCATGGGAGGATGG - Intronic
1091079532 11:132653725-132653747 CAGGCGCTCCCATGGCAGGAGGG + Intronic
1091321607 11:134656221-134656243 CAGGGACGCCTGTCGGAGGAGGG + Intergenic
1091957091 12:4654883-4654905 CCAGGTCACCCATGGGACGAAGG - Exonic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092918964 12:13213863-13213885 CAGAAACACCCATGGTAAGATGG - Intronic
1092939168 12:13391307-13391329 GAGGGCCAGCCATGGGAGGTGGG + Intergenic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1096562277 12:52444748-52444770 CACAGACAACCATGGGAAGAAGG + Intergenic
1101530169 12:105566553-105566575 CCAGGAGACCCATGGGAGCATGG + Intergenic
1102779932 12:115555565-115555587 CTGGGACACTCCTGGGGGGAAGG - Intergenic
1102991833 12:117321540-117321562 CAGGGACACAGATGGGGAGAGGG + Intronic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1103711818 12:122918277-122918299 GGGGGGCACCCAAGGGAGGAAGG - Intergenic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1104720816 12:131044257-131044279 CAAGGGCACCCATGTGAGGACGG - Intronic
1111676410 13:91394737-91394759 CAGGGCCATACAGGGGAGGAGGG + Intergenic
1112862650 13:103851493-103851515 CAGAGACAGCCATGTGATGAAGG - Intergenic
1113289616 13:108890409-108890431 CAGGGACATGCACTGGAGGATGG - Intronic
1113696996 13:112354085-112354107 CCGGGACACCCAGGGAAGGCCGG + Intergenic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1113904558 13:113813152-113813174 CAGGGACTCCCAGGGCGGGAGGG + Exonic
1114083774 14:19221776-19221798 CATGGACACCCAAGCAAGGAAGG - Intergenic
1115357909 14:32468676-32468698 GAGGGACAAAGATGGGAGGAGGG - Intronic
1115576618 14:34717480-34717502 CAGGAACACCTTTGTGAGGAGGG + Intergenic
1118747585 14:68785365-68785387 CAGTGACACTCATGAAAGGAGGG - Intergenic
1121185497 14:91964413-91964435 CTGGCAGACCGATGGGAGGAGGG - Intergenic
1121873479 14:97430337-97430359 CTGGGACACTCACGGAAGGATGG - Intergenic
1122325689 14:100879675-100879697 AGGGGACACGCATGGGAGGAGGG - Intergenic
1202902482 14_GL000194v1_random:51635-51657 CAGGAACCTCCATGGGAGGTGGG - Intergenic
1124109295 15:26772371-26772393 CAGGGACCGCCCTGGGAGGGCGG + Intronic
1124494221 15:30176551-30176573 CCGGGACAGACATGGGAGGTAGG + Intergenic
1124749349 15:32362094-32362116 CCGGGACAGACATGGGAGGTAGG - Intergenic
1125689645 15:41585614-41585636 CTCGGGCACCCTTGGGAGGATGG - Intergenic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130546267 15:84859168-84859190 CAAGGACACCCAGGAGAGCAAGG + Intronic
1131132774 15:89910743-89910765 CTTGGACACTCATGGCAGGAAGG - Exonic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132499122 16:276889-276911 CAGGCATAGCCATTGGAGGAGGG - Intronic
1132573396 16:653782-653804 CAAGGACCACCACGGGAGGACGG + Exonic
1132775317 16:1590454-1590476 CAGCGACACCCAGGGCAGAAAGG - Intronic
1132945005 16:2527761-2527783 CAGGTGCAGCCCTGGGAGGAGGG - Exonic
1132977119 16:2716425-2716447 CAGGGACACTCATGGCCAGAGGG - Intronic
1133042233 16:3066857-3066879 CATGTACACACACGGGAGGATGG - Intronic
1133184499 16:4085871-4085893 CCTGGACACGCATGGGTGGAAGG - Intronic
1135773525 16:25235820-25235842 CAGGGACAACCACCAGAGGACGG + Intergenic
1137568690 16:49550694-49550716 AAGGGACAGCCGTGGGAGCAAGG + Intronic
1138598508 16:58041878-58041900 CAGGGCCAGGCATGGGAGGCGGG - Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1141075618 16:81004409-81004431 CAGGGACTGCCTGGGGAGGAAGG + Intronic
1142218596 16:88841855-88841877 CAGGGACACCCTTGGGGTGCAGG - Intronic
1143582556 17:7835386-7835408 CAGGAAGAGCCCTGGGAGGAAGG + Intergenic
1144642156 17:16943606-16943628 CAGGGGCAGCCATGGGAGAAGGG - Intronic
1144931463 17:18862463-18862485 CAGTAACAGCCATGGGGGGAGGG - Intronic
1145266569 17:21382645-21382667 CATGGACATCCAGGGGAGGAGGG - Intronic
1145812247 17:27771430-27771452 CAGGCCCACCCAGCGGAGGATGG + Intronic
1145831600 17:27920839-27920861 CAGGGACACACATGGGACTTTGG + Intergenic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147255111 17:39176724-39176746 CTGTGGCTCCCATGGGAGGAGGG + Intronic
1147952169 17:44113304-44113326 CAGGGACACCCAGAGGTGGCTGG + Intronic
1148235081 17:45963480-45963502 CAGCCACACCCATGGAAAGAAGG - Intronic
1148597925 17:48871789-48871811 CAGCAACTTCCATGGGAGGAGGG - Intergenic
1149298902 17:55286168-55286190 CAAGGCCAGCCATGGAAGGAAGG + Intronic
1152410055 17:80118568-80118590 CAGGAACACCCATGAGAACAGGG - Intergenic
1153723934 18:7936530-7936552 CACTGACAAGCATGGGAGGAAGG + Intronic
1153758013 18:8302772-8302794 CAGGTAGACACATGGAAGGATGG + Intronic
1154241384 18:12657371-12657393 CGGGGACCCGCAGGGGAGGACGG - Intronic
1154253924 18:12766795-12766817 CAGGGACACCCCTGCAAGGAGGG + Intergenic
1155980509 18:32174865-32174887 TTGGGAAGCCCATGGGAGGAAGG + Intronic
1157435861 18:47668548-47668570 CAGGCACACCCAGGTGTGGATGG - Intergenic
1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG + Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161167813 19:2797797-2797819 CAGGGACAGCCATGGGGCTATGG - Intronic
1161172489 19:2819988-2820010 CAGGGACACGCAGGGGAGGCCGG + Exonic
1161295679 19:3519114-3519136 CAGGGCCCCCCATGCGAGGCTGG + Intronic
1161332838 19:3696574-3696596 AAAGGACACAGATGGGAGGAGGG + Intronic
1161682735 19:5688020-5688042 CAGAGACACCCCTGAGAGGGTGG + Exonic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162265740 19:9572469-9572491 CAGGGACAAAGATGGGAGGCAGG + Intronic
1162966415 19:14158299-14158321 CAGGGACCCCCATGGAGGGAGGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164541973 19:29128237-29128259 CAAGGACACGCAAGGGAGGAAGG + Intergenic
1166296495 19:41892577-41892599 CAGGGACACACATGGGGGCTAGG - Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167103181 19:47416603-47416625 GAAGGAGACCCATTGGAGGAGGG + Intronic
1167103691 19:47418917-47418939 CTGGGAGACCCAGGGGCGGAGGG + Intronic
1167168834 19:47817675-47817697 CTGGGAATCCCATGGGAGCAGGG - Intronic
1167301772 19:48681868-48681890 CAGGGACACACCTATGAGGAGGG + Intergenic
1168267444 19:55230474-55230496 CCGGGAGATCCACGGGAGGACGG + Exonic
1168402513 19:56093566-56093588 CAGGGAAAGGGATGGGAGGAGGG - Intronic
925288761 2:2732523-2732545 CAGAGACAGCCATGGGTGGCCGG + Intergenic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
925544045 2:4999851-4999873 CAGGGAATCCCATGGCAAGAGGG - Intergenic
926242578 2:11099944-11099966 CAGGAAGACAAATGGGAGGACGG - Intergenic
927854244 2:26517947-26517969 TATGGACACCCATGGGAAGGCGG - Intronic
929587825 2:43127219-43127241 CAGGGAGCCCTATCGGAGGAGGG - Intergenic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
932300443 2:70663354-70663376 CAGGGACAGAGATGGGAGAAGGG + Exonic
932350690 2:71029002-71029024 CAGGGACAGCCCAGCGAGGATGG - Intergenic
934504183 2:94878765-94878787 CAGGAACCTCCATGGGAGGTGGG + Intergenic
934536032 2:95134335-95134357 CAGGGAAACACCTGGGAGGGAGG - Intronic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
934901368 2:98162503-98162525 CAGGGTCACCGCTGCGAGGAGGG - Intronic
934974017 2:98787718-98787740 CAGAGAGACCCAGGGGAGGGAGG - Intergenic
935432476 2:102990936-102990958 CATGTGCACCCAAGGGAGGAGGG + Intergenic
936046097 2:109189035-109189057 GAGGGACTCCTATGGGAGGGTGG - Intronic
936075259 2:109397701-109397723 CAGGCACACCCACTGGGGGAAGG - Intronic
936938980 2:117863431-117863453 CAGAGACACCCATGAGCAGAGGG - Intergenic
937330189 2:121021749-121021771 CAGGGAGAGCCAGGGGAGAAGGG + Intergenic
937689361 2:124737403-124737425 TATGAAGACCCATGGGAGGACGG + Intronic
937908806 2:127065433-127065455 ATGGGACACCCAGGGGAGTAGGG - Intronic
937916424 2:127101304-127101326 GAGGGGCACCCACGGGAGGATGG - Intronic
937983391 2:127627749-127627771 CATGGAGACCCATGGGAGTGGGG - Intronic
938652083 2:133393731-133393753 AAAGGACTCCCATGGCAGGAAGG - Intronic
938670160 2:133578687-133578709 AAGAGACATCCATGGGAGGGAGG - Intergenic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
939979967 2:148768057-148768079 CAGGGTCATCCAGGGGAGAAAGG - Intronic
940359793 2:152785142-152785164 CAGGGACACCCAAAAAAGGAGGG + Intergenic
942445405 2:176074236-176074258 GACGGAAACCCAGGGGAGGAGGG - Intergenic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
948491219 2:238314613-238314635 CAGGGCCTCCCAGGGCAGGAGGG - Intergenic
949055404 2:241925483-241925505 CTGGTGCAGCCATGGGAGGAAGG - Intergenic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1169291795 20:4359222-4359244 CAGGGAGACCCTGGGGAGCAGGG - Intergenic
1169630642 20:7626797-7626819 CATGGATACGCATGGTAGGAAGG - Intergenic
1169661414 20:7982384-7982406 CAGGGGCCCCCAGGAGAGGACGG - Exonic
1170143608 20:13149303-13149325 CAGGGACAGCCATGCTAGGATGG - Intronic
1170605710 20:17873889-17873911 AAGGGAAGCCCATGGCAGGAGGG + Intergenic
1170945690 20:20889228-20889250 CAGTGACACTCAGGAGAGGAGGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172777175 20:37414549-37414571 CAGAGACAGCGAGGGGAGGAAGG - Intergenic
1173583782 20:44166627-44166649 CACAGACACCCAGGGGAGGCTGG + Intronic
1174482514 20:50841634-50841656 CAGGGAGCCCCATTGGAGGGAGG + Intronic
1175341015 20:58228814-58228836 CAGGGAGACCGATGGGCGGGCGG + Intergenic
1175777967 20:61664765-61664787 CAGGCAGACCCCTGGAAGGAAGG - Intronic
1175838910 20:62014441-62014463 CAGGCACAGCCATGGGAGTGAGG - Intronic
1176197612 20:63844611-63844633 CAGGACCCCCCAAGGGAGGAGGG - Intergenic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1176621848 21:9066402-9066424 CAGGAACCTCCATGGGAGGTGGG - Intergenic
1178020662 21:28404613-28404635 CATGGACACCTTTGGGAGGGAGG + Intergenic
1179023650 21:37660830-37660852 CGGGGACACCGATGGGAGACAGG - Intronic
1179269932 21:39842950-39842972 CAGGGAAACCCATGTGAGCTGGG - Intergenic
1180081983 21:45491222-45491244 CAGGGAGATCCAGGGAAGGACGG + Exonic
1180294201 22:10871491-10871513 CATGGACACCCAAGCAAGGAAGG + Intergenic
1180497007 22:15900905-15900927 CATGGACACCCAAGCAAGGAAGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180980461 22:19875887-19875909 CAGGGACCCCCAAGGGAGATGGG + Intronic
1181167870 22:20993005-20993027 CAGGGCCACACCTGGCAGGATGG + Intronic
1182010011 22:26992803-26992825 CAGGGGCAGCCTTGGGAGAATGG + Intergenic
1182517036 22:30864811-30864833 CAGTGACACCCATGAGGGGACGG + Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1183738223 22:39655578-39655600 CAGGGACACGGATGTGAAGAAGG - Intronic
1184665666 22:45987643-45987665 CAGGCACATTCCTGGGAGGAAGG + Intergenic
1184683338 22:46084852-46084874 CAGGGATGCCCGTGGGAAGAAGG + Intronic
1184781057 22:46649831-46649853 CAGGGAGGGCCACGGGAGGAAGG + Intronic
1184847156 22:47095756-47095778 CAGGGAGACCCTTGAGAGGAAGG + Intronic
1185046201 22:48529813-48529835 CCAGAGCACCCATGGGAGGATGG - Intronic
949249936 3:1971851-1971873 TAGGGACAGCTCTGGGAGGATGG + Intergenic
949885296 3:8688265-8688287 CAGGGACAGCCCAGCGAGGACGG - Intronic
950206991 3:11088498-11088520 ACGGGACAACAATGGGAGGATGG - Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
953404424 3:42653614-42653636 CATGGACACCCGTGGGGGCAGGG - Intergenic
953630628 3:44613506-44613528 CAGGAACACACATTGGAGAAAGG + Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
954134976 3:48578346-48578368 CAGGGAAAGCCAGGCGAGGATGG - Exonic
954390386 3:50265386-50265408 GTGGGACACCCATCTGAGGAAGG - Intergenic
954622400 3:52003610-52003632 CAGGAACACCAATGGTAGGGAGG - Intergenic
956508200 3:69965134-69965156 CAGTGACACCGACGGGAGAAAGG - Exonic
957164291 3:76651316-76651338 CAGGGACAACAATGGTTGGAAGG - Intronic
959981736 3:112525057-112525079 CAGGGACAGCCCAGCGAGGACGG + Intergenic
961326752 3:126113474-126113496 GTGGGAGACCCAGGGGAGGACGG + Intronic
961346806 3:126268408-126268430 CAGGGAGGCCCATGGGATGGGGG + Intergenic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
963906608 3:150778736-150778758 CAGTAACACCCATGGGTGGTTGG + Intergenic
965042569 3:163529434-163529456 CAGGAACATACATTGGAGGAAGG + Intergenic
965383944 3:168023600-168023622 TGGGGAACCCCATGGGAGGATGG - Intronic
965583004 3:170289471-170289493 CAGGGACAAGAATGGAAGGAAGG + Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
967777478 3:193399513-193399535 GACAGACACTCATGGGAGGATGG - Intergenic
967815520 3:193795240-193795262 CAGGGAAAGGCACGGGAGGAGGG + Intergenic
968574661 4:1360023-1360045 CAGGCACAGGCAGGGGAGGAGGG + Intronic
968864002 4:3196057-3196079 CAGGGAAACCCTTGGAAGGAGGG + Intronic
969486448 4:7474954-7474976 CAGGGACAGTCATGTGAAGATGG - Intronic
969500294 4:7548574-7548596 CAGTGACACACATGGGAGCTGGG + Intronic
969596482 4:8151984-8152006 CAGGAACCCCCATAGGAGGCGGG + Intronic
969716386 4:8870276-8870298 TAGGAAGACCCCTGGGAGGAAGG - Intronic
969788321 4:9474862-9474884 CTGGGACCCCCATGGCAGGGGGG + Intergenic
971009688 4:22419696-22419718 CAGAGAAACCCATGAGAGAAAGG - Intronic
976778989 4:88737837-88737859 CAGGGGCAGCGATGGGAGGCAGG - Intronic
978112248 4:104977160-104977182 CAGTCACAGCCATGGGAGGCAGG + Intergenic
978945526 4:114491211-114491233 AAGGGACACGCATGAGAGGCTGG - Intergenic
981107863 4:140901874-140901896 GAGGGAGAAGCATGGGAGGACGG + Intronic
984057641 4:174949199-174949221 CAGTCACGCCCATGGGATGAGGG - Intronic
986000827 5:3629441-3629463 CAGGAACGCCTGTGGGAGGAAGG + Intergenic
986140427 5:5025123-5025145 CAGGAAGACCCCTGAGAGGAAGG + Intergenic
986254451 5:6090343-6090365 CCGGGACACGCATACGAGGAAGG + Intergenic
987933302 5:24430006-24430028 AAGGGACACCCCTGGGAGACTGG - Intergenic
990516121 5:56532466-56532488 CACTGACACCCATGAAAGGATGG + Intronic
991208796 5:64080857-64080879 TAGGGACACCAAAAGGAGGATGG - Intergenic
991919601 5:71642477-71642499 TAGGGACACCCATAGAGGGACGG - Intronic
992666842 5:79018552-79018574 CATGGACACCCCGGGGATGAGGG + Intronic
994674160 5:102800655-102800677 CAGGGACATTAATGGGAGGGAGG + Intronic
997237076 5:132278818-132278840 CAGGGGCACCCAGAGGTGGAGGG - Intronic
998160055 5:139808264-139808286 CAGGGGCAGACAGGGGAGGAGGG + Intronic
998509021 5:142696020-142696042 AAGGGAGACCCATGTGAGCATGG + Intronic
999843091 5:155449879-155449901 CAGCCACAACAATGGGAGGAAGG - Intergenic
1001965708 5:175908597-175908619 CAGGGAGACACAAGGGAGGGTGG - Intergenic
1002251237 5:177930598-177930620 CAGGGAGACACAAGGGAGGGTGG + Intergenic
1003561574 6:7185027-7185049 CAAGGACCCCCATGGGGGCATGG - Intronic
1004132535 6:12934182-12934204 GAGAGACAGCCATGGGATGACGG - Intronic
1004544469 6:16584028-16584050 CAGCAACACCCAAGGGAGAAGGG + Intronic
1004706133 6:18125412-18125434 CAGAGACGCCCCTGGGAGGAGGG - Intergenic
1004899890 6:20184209-20184231 CAGGCCCACCCATGAGGGGAGGG + Intronic
1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG + Intergenic
1005515841 6:26553400-26553422 CGGGGACAGATATGGGAGGACGG + Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1006632083 6:35436804-35436826 CAGGGAAACACAGGGGAGGTGGG + Intergenic
1006815784 6:36848925-36848947 CAGGTACAGCCAGGGGAGGCAGG - Intergenic
1007654144 6:43442071-43442093 CAGGAACATGCAAGGGAGGAGGG - Intronic
1007662980 6:43497760-43497782 CAGGGAGAACCACGGCAGGAAGG - Intronic
1008320567 6:50107392-50107414 CAAGGGGACCCATGGTAGGAAGG + Intergenic
1012823623 6:104121290-104121312 CAAGAACATCCATGGGAGAAAGG - Intergenic
1013609271 6:111778994-111779016 CAGGGAAACCCTTGTGAGGAGGG - Intronic
1013664849 6:112337162-112337184 CATGGAGATCCATGGGACGATGG - Intergenic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1018911070 6:168101206-168101228 CAGGGACCCCCATGGGCCGGCGG + Intergenic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1020059793 7:5143762-5143784 CATGGACACCCAGGGGAGGGAGG - Intergenic
1020094761 7:5362093-5362115 CAGGGGCACCCCTGGGTGGGCGG - Intronic
1020105313 7:5420030-5420052 CAGGGACAGCCCGGGAAGGAGGG + Intronic
1020168176 7:5823989-5824011 CATGGACACCCAGGGGAGGGAGG + Intergenic
1021951454 7:25779060-25779082 CAGGGACACTCATGAGGGGTGGG - Intergenic
1022340299 7:29461314-29461336 GTGGGAGACCCAGGGGAGGATGG + Intronic
1022643304 7:32207876-32207898 CTGGGACTCCCATGGGGGAAGGG + Intronic
1022644177 7:32215543-32215565 CATGGAGACCAATGGGAGGGAGG + Intronic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024960498 7:54969824-54969846 CAGGGCCACACGTGGAAGGAGGG + Intergenic
1026149099 7:67772961-67772983 CTGGGAAACCCAGGAGAGGATGG - Intergenic
1029380903 7:100213927-100213949 GAGGGTAACCCAGGGGAGGATGG + Intronic
1029548600 7:101224298-101224320 CAGGGACACAGAGGGGCGGACGG - Intergenic
1029693549 7:102198534-102198556 CAGGGAGGTCCATGGGAGGGAGG - Intronic
1031762725 7:125734729-125734751 CAGAGACACCCAAGAGAGAAAGG + Intergenic
1033961756 7:146921989-146922011 CAGTGGCATCCATGGAAGGAAGG - Intronic
1035024593 7:155817528-155817550 CAGCCACTCCCATTGGAGGACGG + Intergenic
1035024621 7:155817627-155817649 CAGCCACTCCCATTGGAGGACGG + Intergenic
1035024641 7:155817693-155817715 CAGCCACTCCCATTGGAGGAGGG + Intergenic
1035024650 7:155817726-155817748 CAGCCACTCCCATTGGAGGACGG + Intergenic
1035024670 7:155817792-155817814 CAGCCACTCCCATTGGAGGAGGG + Intergenic
1035024680 7:155817825-155817847 CAGCCACTCCCATTGGAGGAGGG + Intergenic
1035079692 7:156205502-156205524 CAGGGATCCCCATAGGAGAAAGG - Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035189343 7:157152197-157152219 CAGGGACAGAGCTGGGAGGAAGG + Intronic
1035260660 7:157659436-157659458 CAGGGACAGGGGTGGGAGGATGG + Intronic
1035305540 7:157929124-157929146 CAGGGAAACACAAGGGTGGAAGG - Intronic
1035743516 8:1945801-1945823 CAGGGACAGACGTGGGAGTACGG + Intronic
1036773426 8:11593988-11594010 GAGGGGCAGCCATGGGAGGAAGG - Intergenic
1036905325 8:12703915-12703937 CAGGGACAGCCCAGCGAGGATGG + Intergenic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1037618629 8:20543623-20543645 CAGGGACACCCACAGAAGCAAGG - Intergenic
1037792234 8:21955628-21955650 CAAGGAAACCCCTGGAAGGACGG - Intronic
1037827256 8:22166698-22166720 CAGGGACTCTCCTGGGAGGGTGG + Intronic
1040291908 8:46129839-46129861 CCGGGACACCCCTGGGTGCAGGG + Intergenic
1040881997 8:52215830-52215852 CAGAGATACTCACGGGAGGAGGG - Intronic
1042849402 8:73201174-73201196 CAGGGACACACAGGGTAGAAAGG - Intergenic
1043069446 8:75620415-75620437 CAGCCACACCCATGGGAAGGAGG + Intergenic
1045004507 8:97906297-97906319 CAGGGACCCCCATGGCAGTCTGG - Intronic
1045461055 8:102426210-102426232 CAGGGCAACCAATGGCAGGAAGG - Intergenic
1046777421 8:118179054-118179076 CATTGCCAGCCATGGGAGGAGGG - Intergenic
1047692179 8:127367007-127367029 CAGGGAGTCCCATGGGTAGAAGG + Intergenic
1048344425 8:133566094-133566116 CAGAGACACACAGGGGAGGTGGG - Intronic
1048932393 8:139325447-139325469 CAGGGACCCCCATGTGTGAAAGG - Intergenic
1049388954 8:142358377-142358399 TAGGAACGCTCATGGGAGGAGGG + Intronic
1051237290 9:15014932-15014954 CAGTTACACCCATGGGTGCAGGG + Intergenic
1051347411 9:16164703-16164725 CAGAGACACCCATGGAGTGAAGG + Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053464893 9:38298740-38298762 CAGGGCCGGCCATGGGAGGCAGG - Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055115912 9:72605490-72605512 GAGGGACAACCATGTGAAGAGGG - Intronic
1055574308 9:77647019-77647041 GAGGGACCCCCATGGGAGGCAGG + Intronic
1055641704 9:78324007-78324029 CAGGGACACCCATCCCACGAAGG - Intronic
1056559559 9:87718323-87718345 CTTGCACAACCATGGGAGGAGGG - Intergenic
1057115047 9:92513091-92513113 CAGGGACACCCGTGGCATGGGGG + Intronic
1058868566 9:109183355-109183377 CAGGGAAACCCGTGGAAGCATGG + Intronic
1060864118 9:126981353-126981375 CAAGGACCCCCATGGCAGGGAGG - Intronic
1061954484 9:133954543-133954565 CAGGTCCAGCCATGGGAGGCTGG + Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062306333 9:135908725-135908747 CAAGGAAAGCCATAGGAGGAGGG + Intergenic
1203745036 Un_GL000218v1:36816-36838 CAGGAACCTCCATGGGAGGTGGG - Intergenic
1203565072 Un_KI270744v1:82668-82690 CAGGAACCTCCATGGGAGGTGGG + Intergenic
1187854415 X:23623215-23623237 GAGGGACAACGAGGGGAGGAGGG - Intergenic
1188997401 X:36902988-36903010 CACTGACACCCATGGACGGAAGG - Intergenic
1190732734 X:53235709-53235731 CATGGAGACCCAGAGGAGGAGGG - Intronic
1194293120 X:92100232-92100254 CAGGGACGCGCATGAAAGGAAGG - Intronic
1195491104 X:105470935-105470957 TAGGTACACCAATGAGAGGAAGG - Intronic
1196572041 X:117277604-117277626 CAGAGACACTCATGGGAAAAAGG + Intergenic
1196733471 X:118963869-118963891 CAGTGACCCCCATGGGATGTGGG - Intergenic
1197192493 X:123663404-123663426 CAGGAACAGCAATGGAAGGAGGG + Intronic
1197413800 X:126150551-126150573 GAGGGAAACCCCTAGGAGGAGGG - Intergenic
1199929467 X:152503907-152503929 CCGGGAAAGCCATGGGAGCAAGG - Intergenic
1200081582 X:153579389-153579411 GAGGGAGACCCATGCGAGAAAGG + Intronic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic
1201158369 Y:11151855-11151877 CAGGAACCTCCATGGGAGGTGGG - Intergenic
1201580745 Y:15510067-15510089 CATGGACACACATGAAAGGAAGG - Intergenic
1201774504 Y:17648520-17648542 CAGGGAAACCCCTGGGAGGGCGG + Intergenic
1201827052 Y:18257469-18257491 CAGGGAAACCCCTGGGAGGGCGG - Intergenic