ID: 905915231

View in Genome Browser
Species Human (GRCh38)
Location 1:41679764-41679786
Sequence TTCTAGCCCTAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905915231_905915234 11 Left 905915231 1:41679764-41679786 CCCAGTTCCATCTAGGGCTAGAA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 905915234 1:41679798-41679820 ACCAGAAGCCACATGCCTTGTGG 0: 1
1: 0
2: 1
3: 21
4: 164
905915231_905915238 21 Left 905915231 1:41679764-41679786 CCCAGTTCCATCTAGGGCTAGAA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 905915238 1:41679808-41679830 ACATGCCTTGTGGATGCTCTGGG 0: 1
1: 0
2: 5
3: 30
4: 271
905915231_905915237 20 Left 905915231 1:41679764-41679786 CCCAGTTCCATCTAGGGCTAGAA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 905915237 1:41679807-41679829 CACATGCCTTGTGGATGCTCTGG 0: 1
1: 0
2: 0
3: 24
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905915231 Original CRISPR TTCTAGCCCTAGATGGAACT GGG (reversed) Intronic
901276064 1:7991849-7991871 TTTTAGACCTAGATGGAATGTGG + Intergenic
905915231 1:41679764-41679786 TTCTAGCCCTAGATGGAACTGGG - Intronic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
909883659 1:80912839-80912861 TTCTGGTTCTAGATGGACCTTGG + Intergenic
913260033 1:116989365-116989387 TTATATCCCTAGAAGGAACTAGG - Exonic
920410320 1:205754297-205754319 GTGTAGCCCTTGATGGAAATGGG - Intergenic
921982446 1:221273364-221273386 TTCTAGCACTGAATGGAAATAGG - Intergenic
923040851 1:230318911-230318933 TTCTTGTCCTAGATGGAGATGGG - Intergenic
1067397129 10:45931864-45931886 TTCTAGCCCTAGAAGTAAAATGG + Intergenic
1071370954 10:84951225-84951247 TTCTAGCCCTATATCTAAATAGG - Intergenic
1072027085 10:91470709-91470731 TTCCATCCCAAGATGGAACCAGG + Intronic
1072862768 10:99023393-99023415 TTCTGGACCTAGCTGGGACTGGG + Intronic
1073083994 10:100876853-100876875 TTCTATCCTTAGAGGGAAGTAGG + Intergenic
1080247173 11:30192596-30192618 TACAAGCCCAAGATGGAAGTGGG - Intergenic
1088466910 11:110149327-110149349 TCCCAGCCTTAGATGGCACTTGG - Intronic
1089665112 11:120013446-120013468 TTCTGGCCCTACATGGAAGTTGG - Intergenic
1092114535 12:5989910-5989932 TTCTAGCCCCATATGTAAATTGG + Intronic
1094717839 12:33030978-33031000 TTCTTGCTCAAGATGGAATTGGG + Intergenic
1096628154 12:52907667-52907689 TTCTGGCCCTAGACGGTTCTGGG - Intronic
1098871530 12:75822403-75822425 TCCTAGGCCTAGGTGGAGCTAGG - Intergenic
1113216979 13:108053290-108053312 TTATAGCTGTAGATGGACCTAGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1116968224 14:51037340-51037362 TACTATTCTTAGATGGAACTTGG + Intronic
1117357385 14:54937980-54938002 TTCTAGCCACATCTGGAACTCGG - Intergenic
1118018626 14:61687646-61687668 TTCTAGACCTAAATGGAAAATGG - Intergenic
1119777192 14:77256677-77256699 TTCCAGCCCTTCCTGGAACTGGG - Exonic
1122078646 14:99251957-99251979 TTCTAACCCTACTTTGAACTGGG - Intronic
1123795356 15:23765424-23765446 TGCTATCCCTAGAAGCAACTGGG + Intergenic
1126637389 15:50792640-50792662 TTCCAGCCCTGGATGGATCAAGG + Intergenic
1128478494 15:68017512-68017534 TTCCTGCCCTAGGTGGGACTTGG + Intergenic
1137945119 16:52726503-52726525 TCCTTGGCATAGATGGAACTAGG - Intergenic
1138118316 16:54377934-54377956 TCCTAACCCTAAATGGAACTTGG - Intergenic
1141643662 16:85356140-85356162 CCCTAGCTCTACATGGAACTTGG - Intergenic
1143149493 17:4798774-4798796 TTCAAGCCCAAGGTGGAACTCGG + Intergenic
1149329767 17:55568584-55568606 TCCTAGTCCTAGATCCAACTTGG + Intergenic
1162111645 19:8403047-8403069 GTCTAGCCCTTGCTGGCACTGGG + Intronic
1167487021 19:49768496-49768518 TCCAGGCCCCAGATGGAACTTGG + Intronic
926778200 2:16442855-16442877 TTCTAGCTCTAGCTAGAATTAGG + Intergenic
931602934 2:64021467-64021489 TTCTGGCCTTAGATAAAACTTGG - Intergenic
940641724 2:156351400-156351422 TTCTGGTCCTAGATGAATCTGGG + Intergenic
943389772 2:187250783-187250805 TTATAGAGCTAGATGGAAGTTGG - Intergenic
946066021 2:216987906-216987928 TTCTAGCCTTTGGTGGAAATTGG + Intergenic
948042727 2:234916590-234916612 TTATAGGCCTAGATTTAACTGGG + Intergenic
1172318053 20:33971670-33971692 TTCTAGCCTCAGCTGGCACTTGG - Intergenic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1181346891 22:22225858-22225880 TTCTAGGCCAAGAGGGAAATTGG + Intergenic
1185003505 22:48261740-48261762 TTCTATCCCTTGATGTGACTGGG - Intergenic
952814677 3:37436792-37436814 ATCTGGCCCTGGATGAAACTAGG + Intergenic
953493441 3:43367925-43367947 TTCCAGCCCTGGGTGGCACTTGG - Intronic
958733702 3:97986590-97986612 GGATAGTCCTAGATGGAACTGGG - Intergenic
959273623 3:104246952-104246974 TGCTAGACCTACATGGATCTTGG - Intergenic
964505192 3:157391382-157391404 TTCAAGCCCTAGAGCTAACTTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971102382 4:23482165-23482187 TTCTAGCCCTACCTAGTACTGGG + Intergenic
975565383 4:75748648-75748670 TTCAAGCCCTGCATGGTACTGGG + Intronic
977175172 4:93810840-93810862 TTTCAGCAGTAGATGGAACTGGG + Intergenic
977886555 4:102258384-102258406 TCCTACCCCTGGATGAAACTTGG + Intronic
978285983 4:107077125-107077147 CTTTAGCCCTAGATAAAACTGGG + Intronic
981018713 4:140003119-140003141 TTCTAGAGCTGGAAGGAACTTGG + Intronic
986751329 5:10790606-10790628 CTCTAGCCCTAGAGTGAATTGGG - Intergenic
994442068 5:99820494-99820516 TTGTAGCCCTGAATGTAACTTGG + Intergenic
995536872 5:113145379-113145401 TTGTAGCCCTAGACGGAATATGG - Intronic
996235553 5:121125839-121125861 TTCTTTCCCAAGATGGAACCTGG - Intergenic
999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG + Intergenic
1000456610 5:161457252-161457274 TAATAGCCCTTGATGGAAGTGGG + Intronic
1000641844 5:163712246-163712268 TACTGGCCCTAGATGGAATTAGG - Intergenic
1005860640 6:29897198-29897220 TTCAAGCTCCAGATGGAAGTTGG + Intergenic
1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG + Intergenic
1009628663 6:66166874-66166896 TGCTAGTCCAAGATCGAACTGGG + Intergenic
1010492070 6:76488656-76488678 TTCTAGCTCAAGAAGGAATTTGG - Intergenic
1013340121 6:109205780-109205802 CTCAAGCACTAGATGGAACTAGG - Intergenic
1013462956 6:110393090-110393112 ATGTAACCCTAGGTGGAACTAGG - Exonic
1015255750 6:131177855-131177877 TTCTTGCCTTAGCTGAAACTCGG + Intronic
1018595557 6:165476872-165476894 TTCTAGACCTGGCTGGAATTTGG + Intronic
1023459029 7:40374545-40374567 ATCTAGACATATATGGAACTAGG + Intronic
1026863678 7:73809966-73809988 TTCTGGCCTTAGCTGGAGCTGGG - Intronic
1039428309 8:37505338-37505360 TTCTATCCCTAGGTGGAACCAGG - Intergenic
1044928696 8:97231511-97231533 TTCTAGACCTAGATTTAGCTGGG - Intergenic
1045538269 8:103056079-103056101 TTTTAGACCTAGAAGGGACTTGG + Intronic
1053149248 9:35732366-35732388 TTCTAGCCTGAAAGGGAACTCGG - Exonic
1056145162 9:83721944-83721966 TTCTGGCCCTAGAAGCATCTTGG - Intergenic
1057521952 9:95767127-95767149 TTCTAGACCTGGAAGGGACTGGG - Intergenic
1061155207 9:128856207-128856229 TTCTGGCACCAGATTGAACTGGG - Intronic
1187181967 X:16951285-16951307 TTCTAGCACTAGGTGGAAAATGG - Intronic
1187221152 X:17327537-17327559 TTCTAGCCCTAGGAGCATCTAGG + Intergenic
1193453922 X:81705698-81705720 TTCTAGCCCTTGAAGAAACCTGG - Intergenic