ID: 905917181

View in Genome Browser
Species Human (GRCh38)
Location 1:41693561-41693583
Sequence ACATAGGCATGATGGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905917181_905917186 27 Left 905917181 1:41693561-41693583 CCTTTTACCCATCATGCCTATGT 0: 1
1: 0
2: 2
3: 19
4: 167
Right 905917186 1:41693611-41693633 TCCTTTAACCTGATTGTTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 146
905917181_905917185 26 Left 905917181 1:41693561-41693583 CCTTTTACCCATCATGCCTATGT 0: 1
1: 0
2: 2
3: 19
4: 167
Right 905917185 1:41693610-41693632 ATCCTTTAACCTGATTGTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 133
905917181_905917188 28 Left 905917181 1:41693561-41693583 CCTTTTACCCATCATGCCTATGT 0: 1
1: 0
2: 2
3: 19
4: 167
Right 905917188 1:41693612-41693634 CCTTTAACCTGATTGTTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905917181 Original CRISPR ACATAGGCATGATGGGTAAA AGG (reversed) Intronic
905917181 1:41693561-41693583 ACATAGGCATGATGGGTAAAAGG - Intronic
906773841 1:48510681-48510703 ACCTAAGCATGATGGGAAAAGGG + Intergenic
906886177 1:49651204-49651226 ACAAGGGCATGATAGGGAAAAGG + Intronic
907598093 1:55738814-55738836 ACATAGGCAGGTTGGCTACACGG + Intergenic
907640148 1:56180767-56180789 ACACAGTCATGATGGAAAAACGG - Intergenic
909476046 1:76081939-76081961 GCATAGGCATGAAGTGGAAATGG + Intronic
912873495 1:113331342-113331364 CCATAGGCATGCTATGTAAATGG + Intergenic
915974329 1:160375111-160375133 AGATAGGGAGGATGGGGAAAAGG + Intergenic
916214145 1:162381849-162381871 AGAGAGGCATGATGAGGAAAGGG - Intronic
918211741 1:182357464-182357486 AAAAAGGCATGAATGGTAAAGGG - Intergenic
918231203 1:182534161-182534183 AAATGGGAATGATGGGTAAATGG + Intronic
918504971 1:185244021-185244043 ATATAGGCAGCATGGGTAAATGG - Intronic
921141021 1:212306316-212306338 ACAAAGGCAAGAAGGGAAAAGGG + Intronic
1062940203 10:1415115-1415137 GCAGAGGGATGATGGGTAGATGG + Intronic
1063048236 10:2416089-2416111 AAACAGGCACGAGGGGTAAAGGG + Intergenic
1063706473 10:8435804-8435826 ACATTGGCATGTTAGGTTAATGG + Intergenic
1064876088 10:19995967-19995989 ACATAGGCATGATGGGGACAAGG + Intronic
1067782139 10:49215723-49215745 ACATAAGGCAGATGGGTAAATGG + Intergenic
1069588744 10:69629153-69629175 AGATTGGCATGATGGATAAAAGG - Intergenic
1070487234 10:76942745-76942767 AAACAGGCATGTTGGGGAAAGGG + Intronic
1075910218 10:126118030-126118052 ACATGGGCAAGAAGGGTAAGGGG - Exonic
1081250783 11:40830680-40830702 ACGTCGGCATGAAGGGTAGAGGG - Intronic
1083990038 11:66241352-66241374 ACATAGGCCTGATGGGGTAGGGG - Intronic
1085139262 11:74125592-74125614 AAATAGAGAAGATGGGTAAAAGG - Intronic
1086259402 11:84920314-84920336 AGGAAGGCATGCTGGGTAAAGGG - Intronic
1087047033 11:93850870-93850892 TCATTGGCATCATGGGCAAAGGG + Intergenic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1088830251 11:113530632-113530654 ACATAGGGATGCTGGACAAAGGG - Intergenic
1091158570 11:133397935-133397957 CCATATTAATGATGGGTAAATGG - Intronic
1092675223 12:10910136-10910158 ACATAGGCCTCATGGATAAGGGG - Intronic
1095626482 12:44320221-44320243 ATATAGGCATGATGGCTGACTGG - Intronic
1096163264 12:49398580-49398602 ACATAGGCACTATGGGAAGAAGG + Intronic
1097006108 12:55919084-55919106 ACATATGCAAGATGGGAATATGG + Intronic
1098059575 12:66546869-66546891 ACATAAGCATGATCCATAAAAGG + Intronic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1101135941 12:101743103-101743125 ACAGAGCCATGGTGGTTAAAGGG - Intronic
1101309716 12:103565127-103565149 ACAAGGGCATGATAGGAAAATGG + Intergenic
1102090657 12:110184581-110184603 ACATACTTATGAAGGGTAAAGGG + Intronic
1105737799 13:23289304-23289326 ACATAGGAAGGCTGGGGAAAGGG + Intronic
1109681037 13:65752886-65752908 ACATTAGCAAGATGGCTAAATGG - Intergenic
1109776300 13:67045165-67045187 ACATAAGGATGCTGGGTAAAGGG - Intronic
1110317823 13:74131723-74131745 ACATAGCCATGTTGGTTACATGG + Intronic
1111133682 13:84010367-84010389 ACATAGGCTAGATGTGTAGAAGG + Intergenic
1112648886 13:101369246-101369268 ACATAGCCATTATGGTGAAATGG - Intronic
1117809701 14:59533450-59533472 ACATAAGCAAGATGTGAAAAGGG - Intronic
1118606499 14:67507777-67507799 ACATAGGAATGGTGAGTATAAGG + Intronic
1120152005 14:81046839-81046861 ACAAAGGAATGAAGGTTAAAAGG + Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125509751 15:40286577-40286599 ACTGAGGCATGATGCGTGAAGGG + Intronic
1128119109 15:65133087-65133109 ACATAGGCAGCCTGGGTCAACGG + Exonic
1128714176 15:69894967-69894989 ACATAGGCAAGATGGCAAAGTGG - Intergenic
1130387292 15:83422904-83422926 ACACAGGGATCATGGTTAAAGGG - Intergenic
1131687270 15:94781990-94782012 ACAGAGGCATGAAGCATAAATGG + Intergenic
1131881106 15:96863021-96863043 TCACAGGCAGGATGGGTAAATGG + Intergenic
1134834963 16:17353640-17353662 AGAGATGCATGATGGGTAGATGG - Intronic
1138270313 16:55691350-55691372 ACACAGGACTGATGGGGAAAGGG + Intronic
1140837855 16:78811800-78811822 ACATATGAATGAGGGGTAGAGGG + Intronic
1140975394 16:80055388-80055410 ACATAGGCAGGAAAGATAAACGG + Intergenic
1151039455 17:70841648-70841670 ACATATGCATAATGGGAGAATGG + Intergenic
1152936888 17:83144258-83144280 AAATAGGCAGGGTGGGGAAAGGG - Intergenic
1154062164 18:11072093-11072115 ACATAGGCTTGAGGGGTACCAGG - Intronic
1155085385 18:22452968-22452990 ACATAGGCATGCTCAATAAATGG + Intergenic
1157736169 18:50051651-50051673 CCAGAGCCATGATGGGTACAAGG - Intronic
1158549373 18:58422176-58422198 CCTTGGGCATGATGGGTGAAAGG - Intergenic
1159077575 18:63699331-63699353 AATTAGGGGTGATGGGTAAAGGG - Intronic
1160502549 18:79409456-79409478 ATGGAGGCATGATAGGTAAATGG - Intronic
1162085893 19:8248901-8248923 ACATATGGATGATGGGTAGATGG + Intronic
1162085925 19:8249102-8249124 ACAGATGGATGATGGGTAGATGG + Intronic
1163288769 19:16365125-16365147 ACACAGGCATGATGGGGAAGGGG - Intronic
1163347657 19:16753997-16754019 AGATAGAGATGATGGATAAAAGG - Intronic
1163347696 19:16754288-16754310 AGATAGACATGATGGGTGGATGG - Intronic
1163347746 19:16754606-16754628 AGATAGAGATGATGGATAAAAGG - Intronic
1165075386 19:33277445-33277467 ACGTGGGGATGATGGGCAAATGG - Intergenic
1166702488 19:44890429-44890451 GCAGAGGCATGATGGGTAATGGG + Intergenic
1167466837 19:49654616-49654638 ACAGAGGGGTGATGAGTAAAGGG - Intronic
1167699064 19:51031772-51031794 TCAGAGGAAGGATGGGTAAAGGG - Intronic
928106040 2:28471276-28471298 CCACAGGCATCATGGGTGAAGGG + Intronic
928178830 2:29053357-29053379 ACAGAGGCAAGATGGGAAAGTGG - Exonic
928926560 2:36585769-36585791 ACATTGGGAAGATGGGGAAAGGG + Intronic
929072259 2:38044498-38044520 ACATATGCATAATGGGAAATGGG - Intronic
929173882 2:38958292-38958314 ATATAGGCCTGATGGGGAAAGGG - Intronic
931415220 2:62074231-62074253 ACATAGGCATGATTGATTGAAGG + Intronic
931746062 2:65292906-65292928 ACATGGGCATGCGGGGGAAACGG + Intergenic
938789179 2:134661708-134661730 ACATTTGCATAATGTGTAAATGG - Intronic
940046726 2:149417473-149417495 CCATAGGCATGATGAAGAAAGGG + Intronic
940376782 2:152966807-152966829 ACATCTGCATGATGGGGGAAAGG - Intergenic
945012998 2:205484797-205484819 ACTTCACCATGATGGGTAAAAGG + Intronic
945335041 2:208582026-208582048 ACATAGGCCTGATAGGCCAAGGG - Intronic
1174733950 20:52946181-52946203 ATATAGTCATGATTGGTAGAGGG - Intergenic
1174929384 20:54795607-54795629 AGAAAGGGGTGATGGGTAAACGG - Intergenic
1175279696 20:57794823-57794845 ACAGAGGCAGGATGGGGAAAGGG - Intergenic
1176045899 20:63092445-63092467 ACATTGGGATGATGGGGAAGTGG - Intergenic
1177300612 21:19240338-19240360 ACATCGGCATAATTGCTAAAAGG + Intergenic
1177467328 21:21503431-21503453 ACATAGACATGCTGGATAAAGGG + Intronic
1181434592 22:22902993-22903015 ACGTAGGCCTGCTGGGTACAAGG + Intergenic
1182653534 22:31871575-31871597 AGGTAGGCTTGATGGGTATAAGG - Intronic
949358963 3:3211772-3211794 ACAAATGCATGATGGGTATCTGG + Intergenic
950128001 3:10522434-10522456 AGATAGGCATGATGGTCACAGGG - Intronic
951104753 3:18729938-18729960 ACATAAGCATGAAGGGTCAAGGG - Intergenic
951247873 3:20361939-20361961 ACAAAGGAATGATGTGTTAAAGG - Intergenic
953067161 3:39484208-39484230 ACACAGACATGATAGGGAAAAGG + Intronic
956353140 3:68360478-68360500 ACAAAGGAATGATGAGTAGAAGG + Intronic
956627159 3:71278068-71278090 ACCTGGGCATGCTGGGTGAATGG + Intronic
961090209 3:124104561-124104583 GCATTGGCATGTTGGGTTAAGGG + Intronic
962161721 3:133008164-133008186 ACATATTCATGATGGTGAAATGG - Intergenic
963071799 3:141311041-141311063 TGAGAGGCTTGATGGGTAAATGG - Intergenic
964116881 3:153145702-153145724 ACATAGGATTGATTGGTACATGG + Intergenic
964444823 3:156747828-156747850 GCAAAGGCCTGATGGGTGAAGGG + Intergenic
967211330 3:187172630-187172652 ACATAGGATTGCTGGGTCAAAGG + Intronic
969462064 4:7334176-7334198 ACACAGGCATGTTGGGTGCAGGG + Intronic
970473524 4:16400057-16400079 ACATTGGCATGATCGATTAAAGG - Intergenic
973046421 4:45539206-45539228 ACATAGGCATGATGGAAAGAGGG + Intergenic
973808849 4:54550706-54550728 TCATCGGCATGATGGACAAAGGG + Intergenic
973858256 4:55035043-55035065 ACTGAGGCACGATGGGGAAACGG - Intergenic
974634034 4:64535499-64535521 ACATAGTCATGTTTAGTAAAAGG + Intergenic
976208510 4:82644293-82644315 GCAGAAGCAAGATGGGTAAAGGG - Intronic
977096101 4:92746866-92746888 GCATAGGCCCGATGGGTTAAAGG - Intronic
977118288 4:93061642-93061664 ATTTAGTAATGATGGGTAAAAGG + Intronic
980243657 4:130208475-130208497 AAATATTCAAGATGGGTAAAGGG + Intergenic
983318214 4:166160305-166160327 ACCTAGAAATGATGTGTAAATGG + Intergenic
983358452 4:166696643-166696665 ATAAAGGCATGAAGGGTAAAAGG - Intergenic
986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG + Intergenic
988131883 5:27116983-27117005 ACATATGCATGTTGGGAAATGGG - Intronic
988514903 5:31895831-31895853 ACAGAGGCAGGGTGGGGAAAAGG - Intronic
994879211 5:105464578-105464600 GCATAGGCATGGTGAGTAAGGGG + Intergenic
997092644 5:130875515-130875537 ACATAGGGATGCTTGGTACATGG - Intergenic
998942575 5:147300618-147300640 ACATTGGCATAATGGCAAAAAGG - Intronic
1000684160 5:164226082-164226104 ACAAAGTCATTATGGGTAACTGG + Intergenic
1001200586 5:169712445-169712467 ACATAGCAATGATGAGTACATGG + Intronic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1004545742 6:16596776-16596798 CCAAAGGCAAGATGGGTAGAAGG + Intronic
1004573859 6:16873827-16873849 GCATAGACAAGATGGGTGAATGG - Intergenic
1006113489 6:31762961-31762983 ACAGAGGCAGGATGGGTGCAAGG + Exonic
1007630606 6:43271090-43271112 ACATGGGCAGGATGAATAAAGGG - Intronic
1010548607 6:77191082-77191104 ACATAGGCAGGTTTGCTAAATGG + Intergenic
1011519350 6:88187514-88187536 ATTTAGAAATGATGGGTAAAAGG + Intergenic
1013024379 6:106255287-106255309 ACATAAGCATGATGGGGGAAGGG + Intronic
1013963845 6:115932034-115932056 ACCTAGGCAAGAAGAGTAAATGG + Exonic
1014535193 6:122606192-122606214 ACATAGGGAAGATGTGAAAATGG + Intronic
1014645238 6:123965034-123965056 ACACAGACATTCTGGGTAAAAGG - Intronic
1014664273 6:124217057-124217079 ACATAGCCATACTGGGAAAATGG + Intronic
1015931029 6:138359973-138359995 ACACATGCATGATGGGGAAAGGG + Intergenic
1020982681 7:15091225-15091247 ACAGAGGCAGGAAGGTTAAAAGG + Intergenic
1022355362 7:29609583-29609605 ATAAAAGCATGATGGGGAAAAGG - Intergenic
1026011653 7:66640896-66640918 AGATAGACAAGATGGGTATAAGG + Exonic
1026023051 7:66725758-66725780 ACATAGGCATGCTTTGCAAAAGG + Intronic
1030779908 7:113587541-113587563 TCAGAGGAATGGTGGGTAAAAGG + Intergenic
1036394658 8:8359028-8359050 ACATAGTCATTAAGTGTAAAAGG - Intronic
1036654058 8:10664173-10664195 AGAAAGGCATAAAGGGTAAATGG + Intronic
1036655992 8:10677871-10677893 ACAAGGGCAGGATGGGGAAATGG - Intronic
1036839924 8:12112150-12112172 ACATAGGCAAAATGGGGACAGGG + Intronic
1038208628 8:25493873-25493895 AAATAGGCCTGTTGGGTCAAAGG - Intronic
1040936182 8:52784356-52784378 ACATGGGCATTATGAGTACAAGG + Intergenic
1041501555 8:58544255-58544277 AAATAGCCATGTTGGGAAAAAGG - Intergenic
1042606139 8:70548528-70548550 ACAAAGGGATGATGAGTGAATGG + Intergenic
1042939118 8:74089728-74089750 TGATAAGCATGATGGATAAATGG + Intergenic
1045937688 8:107700421-107700443 ACAGATGGATGATGGGTGAAAGG + Intergenic
1047721747 8:127646572-127646594 AGATAGGCGTGATGGTTAAAAGG + Intergenic
1047740039 8:127799022-127799044 ACATATACATGATGTGGAAATGG + Intergenic
1049047989 8:140167935-140167957 AAATATGCATTATGGATAAAAGG + Intronic
1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG + Intronic
1051666337 9:19470165-19470187 ACAAAGGTATGCTGGGCAAAGGG - Intergenic
1052632984 9:31064700-31064722 ACATAAGCATGTAAGGTAAATGG + Intergenic
1053156416 9:35783458-35783480 GCATAGGCAGGAGGGGTAGATGG - Intergenic
1055117198 9:72617883-72617905 ACATAGACTTCTTGGGTAAATGG - Intronic
1055934715 9:81593955-81593977 ACATAGGCAGGCTGGGCTAAAGG - Intronic
1055998851 9:82193152-82193174 AGAAAGGCAAGATGGGTAATAGG - Intergenic
1056830808 9:89915785-89915807 ACATAGGCATGATTCCTTAAGGG + Intergenic
1057808828 9:98241828-98241850 AGAGAGGCTTGATGGGTATAGGG - Intronic
1194125092 X:90007456-90007478 ACAGAGGCATGATAGGGAAGTGG - Intergenic
1199226892 X:145386615-145386637 AGATAGGCATGCTGGATACATGG - Intergenic
1200987038 Y:9312409-9312431 ACATGTGCATGATGAGTTAATGG + Intergenic
1200987073 Y:9312956-9312978 ACATGTGCATGATGAGTTAATGG + Intergenic
1200987113 Y:9313499-9313521 ACACATGCATGATGAGTTAATGG + Intergenic
1200987148 Y:9314043-9314065 ACATGTGCATGATGAGTTAATGG + Intergenic
1202118440 Y:21498598-21498620 ACATGTGCATGATGAGTTAATGG - Intergenic
1202118553 Y:21500243-21500265 ACATGTGCATGATGAGTTAATGG - Intergenic
1202120892 Y:21522138-21522160 ACATGTGCATGATGAGTTAATGG - Intronic
1202121005 Y:21523783-21523805 ACATGTGCATGATGAGTTAATGG - Intronic
1202123343 Y:21545679-21545701 ACATGTGCATGATGAGTTAATGG - Intronic
1202123456 Y:21547324-21547346 ACATGTGCATGATGAGTTAATGG - Intronic
1202155552 Y:21882057-21882079 ACATGTGCATGATGAGTTAATGG + Intronic
1202155665 Y:21883702-21883724 ACATGTGCATGATGAGTTAATGG + Intronic
1202158000 Y:21905598-21905620 ACATGTGCATGATGAGTTAATGG + Intronic
1202158113 Y:21907243-21907265 ACATGTGCATGATGAGTTAATGG + Intronic
1202184446 Y:22170524-22170546 ACATGTGCATGATGAGTTAATGG + Intronic
1202184562 Y:22172168-22172190 ACATGTGCATGATGAGTTAATGG + Intronic
1202206798 Y:22414233-22414255 ACATGTGCATGATGAGTTAATGG - Intronic
1202206914 Y:22415877-22415899 ACATGTGCATGATGAGTTAATGG - Intronic