ID: 905920196

View in Genome Browser
Species Human (GRCh38)
Location 1:41714182-41714204
Sequence AACCCTCTGATGTTACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905920192_905920196 14 Left 905920192 1:41714145-41714167 CCGAGGGGAGGCTGGAAGAAGGC 0: 1
1: 1
2: 2
3: 40
4: 331
Right 905920196 1:41714182-41714204 AACCCTCTGATGTTACTGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905920196 Original CRISPR AACCCTCTGATGTTACTGGC TGG Intronic
901667989 1:10837320-10837342 AACCCTCTTATGTTACCGAGAGG + Intergenic
904656244 1:32050016-32050038 AACCCTCATATGTTGCTGGTAGG - Intronic
905920196 1:41714182-41714204 AACCCTCTGATGTTACTGGCTGG + Intronic
909780034 1:79532727-79532749 AACCCTCTGTTTTTACAGTCAGG - Intergenic
915481802 1:156191803-156191825 AACCCTCGGATCTTGCTGGTGGG - Intergenic
916380252 1:164201919-164201941 AACCCTCTGATGTTGTTGGTGGG + Intergenic
920568647 1:206998595-206998617 AACCCTCTTATGTTGCTGGTGGG + Intergenic
920723397 1:208411093-208411115 AACCCTCTAATGGCACTGGCTGG - Intergenic
921634882 1:217480521-217480543 AACCCTTTAATGTTGTTGGCAGG + Intronic
922123956 1:222704204-222704226 AACCCTCAGATATTGCTGGTGGG + Intronic
924508773 1:244711308-244711330 AACCCTCTGGTGTTGCTGCAGGG + Intergenic
924760075 1:246976064-246976086 GACCATCTGCTGATACTGGCTGG + Intronic
1063397668 10:5706428-5706450 TGCCCTCTGATATTACTGCCTGG - Intronic
1063867780 10:10385584-10385606 AACCTCCTGAGGTTACTAGCAGG - Intergenic
1070427424 10:76303107-76303129 AACTCTTTGATGTGACTGTCAGG + Intronic
1071982541 10:91018377-91018399 AACCCTCTGCTCTGGCTGGCTGG - Intergenic
1072017074 10:91358973-91358995 AACCCTCTGTTGTTTCAGGCTGG - Intergenic
1072735693 10:97877861-97877883 AACCCCCTGATGTCCTTGGCAGG + Intronic
1077452721 11:2659707-2659729 AACTCTCATATGTTACTGGTGGG - Intronic
1078337473 11:10475461-10475483 AACCCTCTACCTTTACTGGCTGG + Intronic
1080083600 11:28252007-28252029 AACCCTGTAATTGTACTGGCTGG + Intronic
1085254392 11:75164234-75164256 AACGCTCTGAGGTTTCAGGCAGG - Intronic
1088574450 11:111256707-111256729 AGCTCTGTGATCTTACTGGCTGG + Intronic
1088710444 11:112503563-112503585 AACCCTCCGATGACTCTGGCAGG - Intergenic
1089350886 11:117820989-117821011 GACCCTGCGATGATACTGGCAGG - Intronic
1090750400 11:129741860-129741882 AACTTTCTGATGTTGTTGGCAGG - Intergenic
1092017606 12:5172168-5172190 AGCCCTCTGATGCCTCTGGCGGG - Intergenic
1092124291 12:6064823-6064845 AACCCTCTGATGTTTGGAGCTGG - Intronic
1092148863 12:6233346-6233368 TACCCTTTGATTTTCCTGGCTGG + Intronic
1093137358 12:15468247-15468269 AACTTTATGATGTTACTTGCTGG - Intronic
1096442711 12:51658909-51658931 AACCCTCTTATATTGCTGGTAGG + Intronic
1096637039 12:52966639-52966661 AACCCTCATATGTTGCTGGTGGG + Intergenic
1100872861 12:98930313-98930335 AACTCTCATATGTTACTGGTGGG + Intronic
1103747187 12:123133169-123133191 AACCCTCGTGTGTTACTGGTGGG - Intronic
1104018787 12:124977746-124977768 AACCCTCGGCTGTTGCTGGCAGG + Intronic
1105912767 13:24886491-24886513 ATCCCTCTGATGTTATTTTCTGG - Intronic
1107067285 13:36228272-36228294 AACCCTCATATGTTGCTGGTGGG - Intronic
1112405151 13:99113100-99113122 AACCCTCATATGTTGCTGGTGGG - Intergenic
1112484998 13:99811708-99811730 GCCCCTCTGATGATCCTGGCTGG + Intronic
1119550627 14:75510762-75510784 AACCCTCAGATATTGCTGGTAGG + Intergenic
1121169891 14:91844787-91844809 AGCCACCTTATGTTACTGGCAGG + Intronic
1122246073 14:100404494-100404516 ACCCCTCTGGTGTTCCTGGCTGG + Intronic
1128228903 15:66021311-66021333 AACCCTCTCATCTTGCTGACAGG - Intronic
1130273742 15:82465719-82465741 CACCCTCTGATGGTCCTGGGTGG + Intergenic
1130466090 15:84193090-84193112 CACCCTCTGATGGTCCTGGGTGG + Intergenic
1130498173 15:84480446-84480468 CACCCTCTGATGGTCCTGGGTGG - Intergenic
1130588382 15:85197686-85197708 CACCCTCTGATGGTCCTGGGTGG + Intergenic
1131337535 15:91563649-91563671 AGCCCTCTTATGCTACTGACTGG - Intergenic
1135065015 16:19302155-19302177 AACTCTCTGCAGTGACTGGCTGG + Intronic
1135499861 16:22986094-22986116 AATCCTCTGATATTTCTTGCAGG - Intergenic
1137689461 16:50411763-50411785 AACCCTCAAATTTTGCTGGCAGG - Intergenic
1143947030 17:10602360-10602382 GACCCTCTGATGTTACCGACTGG - Intergenic
1144465031 17:15490327-15490349 TCCCCTCTGACGTTGCTGGCTGG - Intronic
1146819467 17:35973290-35973312 AACCATCAGAAGTTTCTGGCAGG + Intergenic
1148661149 17:49333910-49333932 AAGCCTCATATGTTACTGGTAGG + Intronic
1149041148 17:52189947-52189969 AACCCTCGTATATTACTGGAGGG - Intergenic
1150158044 17:62870617-62870639 AAGCCTCTGCTGTTCCTGGCGGG + Intergenic
1158946535 18:62451760-62451782 ATCCCTCTGATACTACTTGCTGG - Intergenic
1159373373 18:67559110-67559132 AATCCTCTCATGCTTCTGGCAGG - Intergenic
1163134630 19:15300852-15300874 AACTCTCAGATGTTTCTGGAGGG - Intronic
925340846 2:3134662-3134684 AACCCTCATATGCTACTGGTGGG + Intergenic
926271166 2:11367205-11367227 AAAGCTCTGATTTTAATGGCTGG + Intergenic
929594836 2:43169589-43169611 AACCCTCTGATCCGACTGGAGGG - Intergenic
929921977 2:46179152-46179174 AACTCCCTGATCTTACAGGCTGG - Intronic
931635187 2:64334230-64334252 AACCCTCTGATGAGACTGTATGG + Intergenic
933152333 2:78930624-78930646 AAACAGCTGATATTACTGGCAGG - Intergenic
937297836 2:120820437-120820459 CAGCCTCTGACGTTACTGCCTGG - Intronic
937932258 2:127216070-127216092 AACCCTCTTATGATAATGGTGGG + Intronic
938963648 2:136365695-136365717 AACCCTCATATATTACTGGTAGG - Intergenic
940979000 2:159980105-159980127 AAACAGCTGATGCTACTGGCAGG + Intronic
942160545 2:173181416-173181438 AACCCTCATACGTTGCTGGCAGG + Intronic
947820740 2:233067645-233067667 AACCCTCAGATGTTGCTAGTAGG - Intronic
1171083448 20:22212558-22212580 AACCTTCTCATATTACTGGTAGG - Intergenic
1171132996 20:22672572-22672594 AACCCTTTTATGTTGCTGGTGGG + Intergenic
1173714636 20:45192144-45192166 CATCCTCTGATGTTGTTGGCAGG + Intergenic
1175587375 20:60152775-60152797 AACTCTCATATGTTGCTGGCAGG - Intergenic
1176073213 20:63237356-63237378 AAACCTGTGATGTCAGTGGCAGG + Intronic
1177333509 21:19693337-19693359 GACCCTATCATGTTAGTGGCTGG + Intergenic
1180129327 21:45816875-45816897 TACGCTCTGATGTGACTGGCAGG + Intronic
1180730395 22:17977592-17977614 AACCCTCCTATGTTGCTGGTGGG + Intronic
1184160679 22:42695460-42695482 ACCTCGCTGATGTCACTGGCTGG + Intronic
950170578 3:10836461-10836483 AACCCTCGTATATTACTGGTGGG - Intronic
953111039 3:39938578-39938600 AACCCTCATATGTTACTGGTGGG - Intronic
954418654 3:50406938-50406960 AACCCTCTGATGATGCTGGAGGG - Intronic
954889511 3:53912029-53912051 AACCCTCATATGTTGCTAGCAGG + Intergenic
956410141 3:68970679-68970701 AACACAGTGATGTAACTGGCTGG + Intergenic
956677222 3:71747239-71747261 AACCCTCAGATGATGCTGGTGGG - Intronic
960469104 3:118038553-118038575 ACCCCTCTGATGACACTGACAGG + Intergenic
961213945 3:125145228-125145250 ATCTCTCTGCTGTTACTGGCTGG + Intronic
961269251 3:125676149-125676171 GACCCTCTGTTGTTGCTTGCTGG + Intergenic
961604605 3:128084289-128084311 GGCCCTCTGAAGTTACTGGATGG + Intronic
961983239 3:131103949-131103971 CACCCCCTGAGGTAACTGGCAGG - Intronic
973738645 4:53898262-53898284 CACACTCAGATGTTACTGGCAGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977921117 4:102643509-102643531 AACCCTCATATGTTGCTGGTGGG - Intronic
981521104 4:145663405-145663427 AACCCTCTCATGACTCTGGCAGG + Intergenic
982058155 4:151574215-151574237 AACCCACTGGTTTTACTGCCTGG - Intronic
985300268 4:188481053-188481075 AACCCTTTGTTGTGACTTGCTGG - Intergenic
986465742 5:8021164-8021186 AACCCCCTCCTGTTACAGGCAGG - Intergenic
988616916 5:32783760-32783782 ATCCCACTGTTGTTACTTGCTGG + Intronic
988793290 5:34628906-34628928 ATGCCTCTGATGTTTCAGGCTGG - Intergenic
991625767 5:68599499-68599521 AAGCTTCTGAAGTTTCTGGCAGG + Intergenic
992053002 5:72957791-72957813 AACCCTCAGATATTGCTGGTGGG - Intronic
992071017 5:73149275-73149297 AACTCTCATATGTTGCTGGCAGG + Intergenic
995643813 5:114288435-114288457 AACCCTCATATGTTACTGATGGG - Intergenic
996793803 5:127322008-127322030 AATCCTCTGATGATACAAGCAGG - Intronic
997551762 5:134759146-134759168 AACCCTCTGATGGTAGTGCAGGG - Intronic
1001253582 5:170167065-170167087 AGCTCTCTGATGGGACTGGCAGG - Intergenic
1001340925 5:170844775-170844797 AACCCTCACATGTTGCTGGTAGG - Intergenic
1003451558 6:6238887-6238909 AACTCTCATATGTTGCTGGCAGG + Intronic
1005455748 6:26018023-26018045 TACCCTCTGATGTTACTGGGCGG - Intergenic
1007260354 6:40559106-40559128 AAGCCTCTGATGATATTGGGGGG + Intronic
1007691885 6:43707752-43707774 GACCCTCTGATATTACAGGTGGG + Intergenic
1013284053 6:108665026-108665048 AACCCTGAGATGGAACTGGCTGG - Intronic
1015071745 6:129102772-129102794 AACTTTCTGATGCTACTGCCAGG + Intronic
1016690338 6:146930555-146930577 TACCCTCTGATGTTACAGCTGGG - Intergenic
1017956117 6:159179151-159179173 AACCCACTGATGTTCATGGAAGG - Intronic
1018378232 6:163233319-163233341 ATTCCTCTGTTTTTACTGGCAGG - Intronic
1021607169 7:22419776-22419798 TTTCCTCTCATGTTACTGGCAGG + Intronic
1021787377 7:24165168-24165190 CACCCTCTGTTGCTACTGGGTGG - Intergenic
1022486058 7:30778621-30778643 AAGCCTCTCCTGTCACTGGCAGG - Intronic
1024187530 7:46967698-46967720 AACACTCATATGTTTCTGGCGGG + Intergenic
1027817707 7:82998297-82998319 AACCCTCTCATGCTTCAGGCAGG + Intronic
1030666315 7:112282507-112282529 AAGCCTCCCATGTTCCTGGCTGG - Intronic
1032611113 7:133415376-133415398 AGCCCTCTGATGCTGCTGGTGGG - Intronic
1033516236 7:142109551-142109573 TACCCTCATATATTACTGGCAGG + Intergenic
1035535814 8:390746-390768 AGCCCTGTGCTGTTCCTGGCTGG + Intergenic
1041373289 8:57187471-57187493 AACCCTCACATGTTGCTGGTGGG + Intergenic
1042901039 8:73727826-73727848 AACCCTCGTATGTTGCTGGTGGG - Intronic
1043023745 8:75040534-75040556 AACCTTCAGATGTTGCTGGGAGG - Intergenic
1045756893 8:105554328-105554350 AACCCTCTTAGGTATCTGGCAGG + Intronic
1047093476 8:121598492-121598514 AACCCTCTTATATTCCTGCCTGG + Intergenic
1047196216 8:122724001-122724023 AACTCTCACATGTTACTGGTGGG - Intergenic
1050668687 9:7971181-7971203 AAGCCAGTGAAGTTACTGGCTGG - Intergenic
1050669561 9:7980817-7980839 AGCCCTCTGATCACACTGGCTGG - Intergenic
1053552156 9:39093971-39093993 AACTCTCTTTTGTTACTGGTGGG - Intronic
1053816287 9:41914118-41914140 AACTCTCTTTTGTTACTGGTGGG - Intronic
1054106547 9:61057802-61057824 AACTCTCTTTTGTTACTGGTGGG - Intergenic
1054614310 9:67273323-67273345 AACTCTCTTTTGTTACTGGTGGG + Intergenic
1057227846 9:93301912-93301934 CACACTCTGAAGTTGCTGGCCGG + Intronic
1057389605 9:94631833-94631855 AACCTTTGGATGTTCCTGGCTGG - Intronic
1058418030 9:104808233-104808255 AACCCTCTGATGTCAGGGCCGGG + Intronic
1185857481 X:3549654-3549676 CACCCTCTGCTGTCACTCGCCGG - Intergenic
1189831363 X:44976940-44976962 AACCCTCACACATTACTGGCAGG - Intronic
1191974400 X:66854955-66854977 AAGCCAGTGAAGTTACTGGCTGG + Intergenic
1195870806 X:109483333-109483355 AACCCTCATATGTTGCTGGTGGG - Intergenic
1197635608 X:128911690-128911712 ATCCCACTGAAGATACTGGCAGG + Intergenic
1199081461 X:143580842-143580864 AACCATCTCATGTTACAGGTGGG + Intergenic